--- /srv/rebuilderd/tmp/rebuilderdz370wl/inputs/r-bioc-annotate_1.90.0+dfsg-1_all.deb +++ /srv/rebuilderd/tmp/rebuilderdz370wl/out/r-bioc-annotate_1.90.0+dfsg-1_all.deb ├── file list │ @@ -1,3 +1,3 @@ │ -rw-r--r-- 0 0 0 4 2026-08-04 13:35:27.000000 debian-binary │ --rw-r--r-- 0 0 0 2324 2026-08-04 13:35:27.000000 control.tar.xz │ --rw-r--r-- 0 0 0 1858772 2026-08-04 13:35:27.000000 data.tar.xz │ +-rw-r--r-- 0 0 0 2288 2026-08-04 13:35:27.000000 control.tar.xz │ +-rw-r--r-- 0 0 0 1862024 2026-08-04 13:35:27.000000 data.tar.xz ├── control.tar.xz │ ├── control.tar │ │ ├── file list │ │ │ @@ -1,3 +1,3 @@ │ │ │ drwxr-xr-x 0 root (0) root (0) 0 2026-08-04 13:35:27.000000 ./ │ │ │ --rw-r--r-- 0 root (0) root (0) 945 2026-08-04 13:35:27.000000 ./control │ │ │ +-rw-r--r-- 0 root (0) root (0) 845 2026-08-04 13:35:27.000000 ./control │ │ │ -rw-r--r-- 0 root (0) root (0) 4713 2026-08-04 13:35:27.000000 ./md5sums │ │ ├── ./control │ │ │ @@ -1,14 +1,14 @@ │ │ │ Package: r-bioc-annotate │ │ │ Version: 1.90.0+dfsg-1 │ │ │ Architecture: all │ │ │ Maintainer: Debian R Packages Maintainers │ │ │ -Installed-Size: 3245 │ │ │ +Installed-Size: 3247 │ │ │ Depends: r-api-4.0, r-api-bioc-3.23, r-bioc-annotationdbi (>= 1.27.5), r-cran-xml, r-bioc-biobase, r-cran-dbi, r-cran-xtable, r-bioc-biocgenerics (>= 0.13.8), r-cran-httr, r-pkg-team-core-architecture │ │ │ -Suggests: r-bioc-genefilter, r-bioc-biostrings (>= 2.25.10), r-bioc-iranges, r-bioc-go.db, r-bioc-org.hs.eg.db, r-cran-runit, r-bioc-biocstyle, r-cran-knitr │ │ │ +Suggests: r-bioc-biostrings (>= 2.25.10), r-bioc-iranges │ │ │ Section: gnu-r │ │ │ Priority: optional │ │ │ Homepage: https://bioconductor.org/packages/annotate/ │ │ │ Description: BioConductor annotation for microarrays │ │ │ This BioConductor module provides methods for annotation for microarrays. │ │ │ . │ │ │ In its current state the basic purpose of annotate is to │ │ ├── ./md5sums │ │ │ ├── ./md5sums │ │ │ │┄ Files differ ├── data.tar.xz │ ├── data.tar │ │ ├── file list │ │ │ @@ -15,16 +15,16 @@ │ │ │ -rw-r--r-- 0 root (0) root (0) 1561 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/Meta/nsInfo.rds │ │ │ -rw-r--r-- 0 root (0) root (0) 1601 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/Meta/package.rds │ │ │ -rw-r--r-- 0 root (0) root (0) 583 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/Meta/vignette.rds │ │ │ -rw-r--r-- 0 root (0) root (0) 4425 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/NAMESPACE │ │ │ -rw-r--r-- 0 root (0) root (0) 1030 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/NEWS.Rd │ │ │ drwxr-xr-x 0 root (0) root (0) 0 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/R/ │ │ │ -rw-r--r-- 0 root (0) root (0) 1058 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/R/annotate │ │ │ --rw-r--r-- 0 root (0) root (0) 422351 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/R/annotate.rdb │ │ │ --rw-r--r-- 0 root (0) root (0) 3929 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/R/annotate.rdx │ │ │ +-rw-r--r-- 0 root (0) root (0) 422363 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/R/annotate.rdb │ │ │ +-rw-r--r-- 0 root (0) root (0) 3925 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/R/annotate.rdx │ │ │ drwxr-xr-x 0 root (0) root (0) 0 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/data/ │ │ │ -rw-r--r-- 0 root (0) root (0) 51948 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/data/hgByChroms.rda │ │ │ -rw-r--r-- 0 root (0) root (0) 290 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/data/hgCLengths.rda │ │ │ -rw-r--r-- 0 root (0) root (0) 113816 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/data/hgu95AProbLocs.rda │ │ │ -rw-r--r-- 0 root (0) root (0) 93792 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/data/hgu95Achroloc.rda │ │ │ -rw-r--r-- 0 root (0) root (0) 53048 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/data/hgu95Achrom.rda │ │ │ -rw-r--r-- 0 root (0) root (0) 72340 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/data/hgu95All.rda │ │ │ @@ -51,17 +51,17 @@ │ │ │ -rw-r--r-- 0 root (0) root (0) 667819 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/doc/useDataPkgs.html │ │ │ -rw-r--r-- 0 root (0) root (0) 1573 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/doc/useProbeInfo.R │ │ │ -rw-r--r-- 0 root (0) root (0) 4671 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/doc/useProbeInfo.Rnw │ │ │ -rw-r--r-- 0 root (0) root (0) 77026 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/doc/useProbeInfo.pdf │ │ │ drwxr-xr-x 0 root (0) root (0) 0 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/help/ │ │ │ -rw-r--r-- 0 root (0) root (0) 5620 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/help/AnIndex │ │ │ -rw-r--r-- 0 root (0) root (0) 1653 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/help/aliases.rds │ │ │ --rw-r--r-- 0 root (0) root (0) 141165 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/help/annotate.rdb │ │ │ --rw-r--r-- 0 root (0) root (0) 1518 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/help/annotate.rdx │ │ │ --rw-r--r-- 0 root (0) root (0) 706 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/help/paths.rds │ │ │ +-rw-r--r-- 0 root (0) root (0) 142844 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/help/annotate.rdb │ │ │ +-rw-r--r-- 0 root (0) root (0) 1524 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/help/annotate.rdx │ │ │ +-rw-r--r-- 0 root (0) root (0) 723 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/help/paths.rds │ │ │ drwxr-xr-x 0 root (0) root (0) 0 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/html/ │ │ │ -rw-r--r-- 0 root (0) root (0) 29819 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/html/00Index.html │ │ │ -rw-r--r-- 0 root (0) root (0) 2133 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/html/R.css │ │ │ drwxr-xr-x 0 root (0) root (0) 0 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/misc/ │ │ │ -rw-r--r-- 0 root (0) root (0) 24761 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/misc/demowrite.html │ │ │ -rw-r--r-- 0 root (0) root (0) 9213 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/misc/pmLinkGen.Rnw │ │ │ -rw-r--r-- 0 root (0) root (0) 70288 2026-08-04 13:35:27.000000 ./usr/lib/R/site-library/annotate/misc/pmLinkGen.pdf │ │ ├── ./usr/lib/R/site-library/annotate/R/annotate.rdb │ │ │ ├── Rscript --vanilla - {} │ │ │ │ @@ -406,15 +406,15 @@ │ │ │ │ "imports" = " nrow = "nrow", ".__T__revmap:AnnotationDbi" = ".__T__revmap:AnnotationDbi", " │ │ │ │ "imports" = " revmap = "revmap"), Biobase = c(annotation = "annotation", " │ │ │ │ "imports" = " ".__T__contents:Biobase" = ".__T__contents:Biobase", contents = "contents", " │ │ │ │ "imports" = " ".__T__exprs:Biobase" = ".__T__exprs:Biobase", exprs = "exprs", " │ │ │ │ "imports" = " ".__T__featureNames:Biobase" = ".__T__featureNames:Biobase", " │ │ │ │ "imports" = " featureNames = "featureNames"))" │ │ │ │ "lazydata" = "" │ │ │ │ - "path" = ""/home/moeller/Salsa/r-bioc-annotate/debian/r-bioc-annotate/usr/lib/R/site-library/annotate"" │ │ │ │ + "path" = ""/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/debian/r-bioc-annotate/usr/lib/R/site-library/annotate"" │ │ │ │ "spec" = "c(name = "annotate", version = "1.90.0")" │ │ │ │ } │ │ │ │ │ │ │ │ .__S3MethodsTable__. (environment) = │ │ │ │ { │ │ │ │ } │ │ ├── ./usr/lib/R/site-library/annotate/R/annotate.rdx │ │ │ ├── annotate.rdx-content │ │ │ │ ├── Rscript --vanilla -e 'args <- commandArgs(TRUE); readRDS(args[1])' {} │ │ │ │ │ @@ -11,1044 +11,1044 @@ │ │ │ │ │ $variables$.__C__homoData │ │ │ │ │ [1] 2780 363 │ │ │ │ │ │ │ │ │ │ $variables$.__C__pubMedAbst │ │ │ │ │ [1] 3143 358 │ │ │ │ │ │ │ │ │ │ $variables$.__NAMESPACE__. │ │ │ │ │ -[1] 9108 52 │ │ │ │ │ +[1] 9120 52 │ │ │ │ │ │ │ │ │ │ $variables$.__S3MethodsTable__. │ │ │ │ │ -[1] 9291 52 │ │ │ │ │ +[1] 9303 52 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__KEGG2heatmap:annotate` │ │ │ │ │ -[1] 14067 52 │ │ │ │ │ +[1] 14079 52 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__KEGGmnplot:annotate` │ │ │ │ │ -[1] 21631 52 │ │ │ │ │ +[1] 21643 52 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__abstText:annotate` │ │ │ │ │ -[1] 23039 53 │ │ │ │ │ +[1] 23051 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__allValidKeys:annotate` │ │ │ │ │ -[1] 27448 53 │ │ │ │ │ +[1] 27460 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__articleTitle:annotate` │ │ │ │ │ -[1] 28870 53 │ │ │ │ │ +[1] 28882 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__authors:annotate` │ │ │ │ │ -[1] 30282 53 │ │ │ │ │ +[1] 30294 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__chromInfo:annotate` │ │ │ │ │ -[1] 31700 53 │ │ │ │ │ +[1] 31712 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__chromLengths:annotate` │ │ │ │ │ -[1] 33809 53 │ │ │ │ │ +[1] 33821 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__chromLocs:annotate` │ │ │ │ │ -[1] 35221 53 │ │ │ │ │ +[1] 35233 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__chromNames:annotate` │ │ │ │ │ -[1] 36753 53 │ │ │ │ │ +[1] 36765 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__dataSource:annotate` │ │ │ │ │ -[1] 38173 53 │ │ │ │ │ +[1] 38185 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__fileName:BiocGenerics` │ │ │ │ │ -[1] 39630 53 │ │ │ │ │ +[1] 39642 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__geneSymbols:annotate` │ │ │ │ │ -[1] 41060 53 │ │ │ │ │ +[1] 41072 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__homoACC:annotate` │ │ │ │ │ -[1] 42467 53 │ │ │ │ │ +[1] 42479 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__homoHGID:annotate` │ │ │ │ │ -[1] 43878 53 │ │ │ │ │ +[1] 43890 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__homoLL:annotate` │ │ │ │ │ -[1] 45278 53 │ │ │ │ │ +[1] 45290 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__homoOrg:annotate` │ │ │ │ │ -[1] 46685 53 │ │ │ │ │ +[1] 46697 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__homoPS:annotate` │ │ │ │ │ -[1] 48085 53 │ │ │ │ │ +[1] 48097 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__homoType:annotate` │ │ │ │ │ -[1] 49490 53 │ │ │ │ │ +[1] 49502 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__homoURL:annotate` │ │ │ │ │ -[1] 50900 53 │ │ │ │ │ +[1] 50912 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__initialize:methods` │ │ │ │ │ -[1] 180138 53 │ │ │ │ │ +[1] 180150 53 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__isValidKey:annotate` │ │ │ │ │ -[1] 185231 54 │ │ │ │ │ +[1] 185243 54 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__journal:annotate` │ │ │ │ │ -[1] 186649 54 │ │ │ │ │ +[1] 186661 54 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__mainPage:annotate` │ │ │ │ │ -[1] 188092 54 │ │ │ │ │ +[1] 188104 54 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__nChrom:annotate` │ │ │ │ │ -[1] 189639 54 │ │ │ │ │ +[1] 189651 54 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__organism:BiocGenerics` │ │ │ │ │ -[1] 191814 54 │ │ │ │ │ +[1] 191826 54 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__pageText:annotate` │ │ │ │ │ -[1] 193246 54 │ │ │ │ │ +[1] 193258 54 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__pageTitle:annotate` │ │ │ │ │ -[1] 194684 54 │ │ │ │ │ +[1] 194696 54 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__pmid:annotate` │ │ │ │ │ -[1] 196094 54 │ │ │ │ │ +[1] 196106 54 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__probesToChrom:annotate` │ │ │ │ │ -[1] 197534 54 │ │ │ │ │ +[1] 197546 54 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__pubDate:annotate` │ │ │ │ │ -[1] 198952 54 │ │ │ │ │ +[1] 198964 54 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__pubMedAbst:annotate` │ │ │ │ │ -[1] 199694 54 │ │ │ │ │ +[1] 199706 54 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__show:methods` │ │ │ │ │ -[1] 281151 54 │ │ │ │ │ +[1] 281163 54 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__sidePage:annotate` │ │ │ │ │ -[1] 282595 54 │ │ │ │ │ +[1] 282607 54 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__toFile:annotate` │ │ │ │ │ -[1] 285176 54 │ │ │ │ │ +[1] 285188 54 │ │ │ │ │ │ │ │ │ │ $variables$`.__T__topPage:annotate` │ │ │ │ │ -[1] 286624 54 │ │ │ │ │ +[1] 286636 54 │ │ │ │ │ │ │ │ │ │ $variables$.blastSequencesToDNAMultipleAlignment │ │ │ │ │ -[1] 286678 1034 │ │ │ │ │ +[1] 286690 1034 │ │ │ │ │ │ │ │ │ │ $variables$.blastSequencesToDataFrame │ │ │ │ │ -[1] 287712 1376 │ │ │ │ │ +[1] 287724 1376 │ │ │ │ │ │ │ │ │ │ $variables$.buildAnnotateOpts │ │ │ │ │ -[1] 289088 824 │ │ │ │ │ +[1] 289100 824 │ │ │ │ │ │ │ │ │ │ $variables$.defineBaseSelectSQL │ │ │ │ │ -[1] 289912 1158 │ │ │ │ │ +[1] 289924 1158 │ │ │ │ │ │ │ │ │ │ $variables$.efetch │ │ │ │ │ -[1] 291070 831 │ │ │ │ │ +[1] 291082 831 │ │ │ │ │ │ │ │ │ │ $variables$.getIdTag │ │ │ │ │ -[1] 291901 534 │ │ │ │ │ +[1] 291913 534 │ │ │ │ │ │ │ │ │ │ $variables$.getNcbiURL │ │ │ │ │ -[1] 292435 566 │ │ │ │ │ +[1] 292447 566 │ │ │ │ │ │ │ │ │ │ $variables$.handleXML │ │ │ │ │ -[1] 293001 927 │ │ │ │ │ +[1] 293013 927 │ │ │ │ │ │ │ │ │ │ $variables$.isMissingGOEntry │ │ │ │ │ -[1] 293928 282 │ │ │ │ │ +[1] 293940 282 │ │ │ │ │ │ │ │ │ │ $variables$.onLoad │ │ │ │ │ -[1] 294210 595 │ │ │ │ │ +[1] 294222 595 │ │ │ │ │ │ │ │ │ │ $variables$.packageName │ │ │ │ │ -[1] 294805 53 │ │ │ │ │ +[1] 294817 53 │ │ │ │ │ │ │ │ │ │ $variables$.repositories │ │ │ │ │ -[1] 294989 54 │ │ │ │ │ +[1] 295001 54 │ │ │ │ │ │ │ │ │ │ $variables$.setDefaultRepositories │ │ │ │ │ -[1] 295043 597 │ │ │ │ │ +[1] 295055 597 │ │ │ │ │ │ │ │ │ │ $variables$.test │ │ │ │ │ -[1] 295640 232 │ │ │ │ │ +[1] 295652 232 │ │ │ │ │ │ │ │ │ │ $variables$.transformAccession │ │ │ │ │ -[1] 295872 456 │ │ │ │ │ +[1] 295884 456 │ │ │ │ │ │ │ │ │ │ $variables$.tryParseResult │ │ │ │ │ -[1] 296328 2359 │ │ │ │ │ +[1] 296340 2359 │ │ │ │ │ │ │ │ │ │ $variables$ACC2homology │ │ │ │ │ -[1] 298687 929 │ │ │ │ │ +[1] 298699 929 │ │ │ │ │ │ │ │ │ │ $variables$ACCNUMStats │ │ │ │ │ -[1] 299616 476 │ │ │ │ │ +[1] 299628 476 │ │ │ │ │ │ │ │ │ │ $variables$GO2heatmap │ │ │ │ │ -[1] 300092 830 │ │ │ │ │ +[1] 300104 830 │ │ │ │ │ │ │ │ │ │ $variables$GOmnplot │ │ │ │ │ -[1] 300922 1480 │ │ │ │ │ +[1] 300934 1480 │ │ │ │ │ │ │ │ │ │ $variables$HGID2homology │ │ │ │ │ -[1] 302402 1119 │ │ │ │ │ +[1] 302414 1119 │ │ │ │ │ │ │ │ │ │ $variables$KEGG2heatmap │ │ │ │ │ -[1] 303521 453 │ │ │ │ │ +[1] 303533 453 │ │ │ │ │ │ │ │ │ │ $variables$KEGGmnplot │ │ │ │ │ -[1] 303974 474 │ │ │ │ │ +[1] 303986 474 │ │ │ │ │ │ │ │ │ │ $variables$LL2homology │ │ │ │ │ -[1] 304448 779 │ │ │ │ │ +[1] 304460 779 │ │ │ │ │ │ │ │ │ │ $variables$PMIDAmat │ │ │ │ │ -[1] 305227 1561 │ │ │ │ │ +[1] 305239 1561 │ │ │ │ │ │ │ │ │ │ $variables$PWAmat │ │ │ │ │ -[1] 306788 2232 │ │ │ │ │ +[1] 306800 2232 │ │ │ │ │ │ │ │ │ │ $variables$UniGeneQuery │ │ │ │ │ -[1] 309020 1022 │ │ │ │ │ +[1] 309032 1022 │ │ │ │ │ │ │ │ │ │ $variables$abstText │ │ │ │ │ -[1] 310042 400 │ │ │ │ │ +[1] 310054 400 │ │ │ │ │ │ │ │ │ │ $variables$accessionToUID │ │ │ │ │ -[1] 310442 1375 │ │ │ │ │ +[1] 310454 1375 │ │ │ │ │ │ │ │ │ │ $variables$allValidKeys │ │ │ │ │ -[1] 311817 401 │ │ │ │ │ +[1] 311829 401 │ │ │ │ │ │ │ │ │ │ $variables$annObjPrefix │ │ │ │ │ -[1] 312218 471 │ │ │ │ │ +[1] 312230 471 │ │ │ │ │ │ │ │ │ │ $variables$annPkgName │ │ │ │ │ -[1] 312689 708 │ │ │ │ │ +[1] 312701 708 │ │ │ │ │ │ │ │ │ │ $variables$aqListGOIDs │ │ │ │ │ -[1] 313397 1596 │ │ │ │ │ +[1] 313409 1596 │ │ │ │ │ │ │ │ │ │ $variables$articleTitle │ │ │ │ │ -[1] 314993 402 │ │ │ │ │ +[1] 315005 402 │ │ │ │ │ │ │ │ │ │ $variables$authors │ │ │ │ │ -[1] 315395 399 │ │ │ │ │ +[1] 315407 399 │ │ │ │ │ │ │ │ │ │ $variables$blastSequences │ │ │ │ │ -[1] 315794 1551 │ │ │ │ │ +[1] 315806 1551 │ │ │ │ │ │ │ │ │ │ $variables$buildChromLocation │ │ │ │ │ -[1] 317345 2888 │ │ │ │ │ +[1] 317357 2888 │ │ │ │ │ │ │ │ │ │ $variables$buildPubMedAbst │ │ │ │ │ -[1] 320233 4035 │ │ │ │ │ +[1] 320245 4035 │ │ │ │ │ │ │ │ │ │ $variables$checkArgs │ │ │ │ │ -[1] 324268 1088 │ │ │ │ │ +[1] 324280 1088 │ │ │ │ │ │ │ │ │ │ $variables$chrCats │ │ │ │ │ -[1] 325356 9971 │ │ │ │ │ +[1] 325368 9971 │ │ │ │ │ │ │ │ │ │ $variables$chromInfo │ │ │ │ │ -[1] 335327 402 │ │ │ │ │ +[1] 335339 402 │ │ │ │ │ │ │ │ │ │ $variables$chromLengths │ │ │ │ │ -[1] 335729 403 │ │ │ │ │ +[1] 335741 403 │ │ │ │ │ │ │ │ │ │ $variables$chromLocs │ │ │ │ │ -[1] 336132 401 │ │ │ │ │ +[1] 336144 401 │ │ │ │ │ │ │ │ │ │ $variables$chromNames │ │ │ │ │ -[1] 336533 403 │ │ │ │ │ +[1] 336545 403 │ │ │ │ │ │ │ │ │ │ $variables$clearRepository │ │ │ │ │ -[1] 336936 687 │ │ │ │ │ +[1] 336948 687 │ │ │ │ │ │ │ │ │ │ $variables$compatibleVersions │ │ │ │ │ -[1] 337623 1021 │ │ │ │ │ +[1] 337635 1021 │ │ │ │ │ │ │ │ │ │ $variables$createLLChrCats │ │ │ │ │ -[1] 338644 1109 │ │ │ │ │ +[1] 338656 1109 │ │ │ │ │ │ │ │ │ │ $variables$createMAPIncMat │ │ │ │ │ -[1] 339753 1097 │ │ │ │ │ +[1] 339765 1097 │ │ │ │ │ │ │ │ │ │ $variables$dataSource │ │ │ │ │ -[1] 340850 403 │ │ │ │ │ +[1] 340862 403 │ │ │ │ │ │ │ │ │ │ $variables$dropECode │ │ │ │ │ -[1] 341253 712 │ │ │ │ │ +[1] 341265 712 │ │ │ │ │ │ │ │ │ │ $variables$entrezGeneByID │ │ │ │ │ -[1] 341965 500 │ │ │ │ │ +[1] 341977 500 │ │ │ │ │ │ │ │ │ │ $variables$entrezGeneQuery │ │ │ │ │ -[1] 342465 845 │ │ │ │ │ +[1] 342477 845 │ │ │ │ │ │ │ │ │ │ $variables$filterGOByOntology │ │ │ │ │ -[1] 343310 646 │ │ │ │ │ +[1] 343322 646 │ │ │ │ │ │ │ │ │ │ $variables$findChr4LL │ │ │ │ │ -[1] 343956 1152 │ │ │ │ │ +[1] 343968 1152 │ │ │ │ │ │ │ │ │ │ $variables$findNeighbors │ │ │ │ │ -[1] 345108 3370 │ │ │ │ │ +[1] 345120 3370 │ │ │ │ │ │ │ │ │ │ $variables$genbank │ │ │ │ │ -[1] 348478 1413 │ │ │ │ │ +[1] 348490 1413 │ │ │ │ │ │ │ │ │ │ $variables$geneSymbols │ │ │ │ │ -[1] 349891 403 │ │ │ │ │ +[1] 349903 403 │ │ │ │ │ │ │ │ │ │ $variables$getAnnMap │ │ │ │ │ -[1] 350294 3469 │ │ │ │ │ +[1] 350306 3469 │ │ │ │ │ │ │ │ │ │ $variables$getBoundary │ │ │ │ │ -[1] 353763 565 │ │ │ │ │ +[1] 353775 565 │ │ │ │ │ │ │ │ │ │ $variables$getCells │ │ │ │ │ -[1] 354328 1263 │ │ │ │ │ +[1] 354340 1263 │ │ │ │ │ │ │ │ │ │ $variables$getEG │ │ │ │ │ -[1] 355591 299 │ │ │ │ │ +[1] 355603 299 │ │ │ │ │ │ │ │ │ │ $variables$getEvidence │ │ │ │ │ -[1] 355890 548 │ │ │ │ │ +[1] 355902 548 │ │ │ │ │ │ │ │ │ │ $variables$getGI │ │ │ │ │ -[1] 356438 869 │ │ │ │ │ +[1] 356450 869 │ │ │ │ │ │ │ │ │ │ $variables$getGO │ │ │ │ │ -[1] 357307 258 │ │ │ │ │ +[1] 357319 258 │ │ │ │ │ │ │ │ │ │ $variables$getGOChildren │ │ │ │ │ -[1] 357565 1534 │ │ │ │ │ +[1] 357577 1534 │ │ │ │ │ │ │ │ │ │ $variables$getGOOntology │ │ │ │ │ -[1] 359099 735 │ │ │ │ │ +[1] 359111 735 │ │ │ │ │ │ │ │ │ │ $variables$getGOParents │ │ │ │ │ -[1] 359834 1638 │ │ │ │ │ +[1] 359846 1638 │ │ │ │ │ │ │ │ │ │ $variables$getGOTerm │ │ │ │ │ -[1] 361472 1213 │ │ │ │ │ +[1] 361484 1213 │ │ │ │ │ │ │ │ │ │ $variables$getGOdesc │ │ │ │ │ -[1] 362685 1077 │ │ │ │ │ +[1] 362697 1077 │ │ │ │ │ │ │ │ │ │ $variables$getGPLNames │ │ │ │ │ -[1] 363762 906 │ │ │ │ │ +[1] 363774 906 │ │ │ │ │ │ │ │ │ │ $variables$getOntology │ │ │ │ │ -[1] 364668 794 │ │ │ │ │ +[1] 364680 794 │ │ │ │ │ │ │ │ │ │ $variables$getOrgNameNCode │ │ │ │ │ -[1] 365462 1279 │ │ │ │ │ +[1] 365474 1279 │ │ │ │ │ │ │ │ │ │ $variables$getPMID │ │ │ │ │ -[1] 366741 260 │ │ │ │ │ +[1] 366753 260 │ │ │ │ │ │ │ │ │ │ $variables$getPMInfo │ │ │ │ │ -[1] 367001 5276 │ │ │ │ │ +[1] 367013 5276 │ │ │ │ │ │ │ │ │ │ $variables$getQuery4Affy │ │ │ │ │ -[1] 372277 529 │ │ │ │ │ +[1] 372289 529 │ │ │ │ │ │ │ │ │ │ $variables$getQuery4EN │ │ │ │ │ -[1] 372806 993 │ │ │ │ │ +[1] 372818 993 │ │ │ │ │ │ │ │ │ │ $variables$getQuery4ENSEMBL │ │ │ │ │ -[1] 373799 1508 │ │ │ │ │ +[1] 373811 1508 │ │ │ │ │ │ │ │ │ │ $variables$getQuery4FB │ │ │ │ │ -[1] 375307 1153 │ │ │ │ │ +[1] 375319 1153 │ │ │ │ │ │ │ │ │ │ $variables$getQuery4GB │ │ │ │ │ -[1] 376460 554 │ │ │ │ │ +[1] 376472 554 │ │ │ │ │ │ │ │ │ │ $variables$getQuery4GO │ │ │ │ │ -[1] 377014 575 │ │ │ │ │ +[1] 377026 575 │ │ │ │ │ │ │ │ │ │ $variables$getQuery4OMIM │ │ │ │ │ -[1] 377589 994 │ │ │ │ │ +[1] 377601 994 │ │ │ │ │ │ │ │ │ │ $variables$getQuery4SP │ │ │ │ │ -[1] 378583 506 │ │ │ │ │ +[1] 378595 506 │ │ │ │ │ │ │ │ │ │ $variables$getQuery4TR │ │ │ │ │ -[1] 379089 629 │ │ │ │ │ +[1] 379101 629 │ │ │ │ │ │ │ │ │ │ $variables$getQuery4UG │ │ │ │ │ -[1] 379718 1531 │ │ │ │ │ +[1] 379730 1531 │ │ │ │ │ │ │ │ │ │ $variables$getQueryLink │ │ │ │ │ -[1] 381249 462 │ │ │ │ │ +[1] 381261 462 │ │ │ │ │ │ │ │ │ │ $variables$getRepositories │ │ │ │ │ -[1] 381711 221 │ │ │ │ │ +[1] 381723 221 │ │ │ │ │ │ │ │ │ │ $variables$getSAGEFileInfo │ │ │ │ │ -[1] 381932 999 │ │ │ │ │ +[1] 381944 999 │ │ │ │ │ │ │ │ │ │ $variables$getSAGEGPL │ │ │ │ │ -[1] 382931 560 │ │ │ │ │ +[1] 382943 560 │ │ │ │ │ │ │ │ │ │ $variables$getSEQ │ │ │ │ │ -[1] 383491 723 │ │ │ │ │ +[1] 383503 723 │ │ │ │ │ │ │ │ │ │ $variables$getSYMBOL │ │ │ │ │ -[1] 384214 296 │ │ │ │ │ +[1] 384226 296 │ │ │ │ │ │ │ │ │ │ $variables$getTDRows │ │ │ │ │ -[1] 384510 400 │ │ │ │ │ +[1] 384522 400 │ │ │ │ │ │ │ │ │ │ $variables$getURL2 │ │ │ │ │ -[1] 384910 375 │ │ │ │ │ +[1] 384922 375 │ │ │ │ │ │ │ │ │ │ $variables$getUniqAnnItem │ │ │ │ │ -[1] 385285 276 │ │ │ │ │ +[1] 385297 276 │ │ │ │ │ │ │ │ │ │ $variables$getValidChr │ │ │ │ │ -[1] 385561 637 │ │ │ │ │ +[1] 385573 637 │ │ │ │ │ │ │ │ │ │ $variables$hasGOannote │ │ │ │ │ -[1] 386198 1168 │ │ │ │ │ +[1] 386210 1168 │ │ │ │ │ │ │ │ │ │ $variables$homoACC │ │ │ │ │ -[1] 387366 399 │ │ │ │ │ +[1] 387378 399 │ │ │ │ │ │ │ │ │ │ $variables$homoData │ │ │ │ │ -[1] 387765 470 │ │ │ │ │ +[1] 387777 470 │ │ │ │ │ │ │ │ │ │ $variables$homoHGID │ │ │ │ │ -[1] 388235 401 │ │ │ │ │ +[1] 388247 401 │ │ │ │ │ │ │ │ │ │ $variables$homoLL │ │ │ │ │ -[1] 388636 398 │ │ │ │ │ +[1] 388648 398 │ │ │ │ │ │ │ │ │ │ $variables$homoOrg │ │ │ │ │ -[1] 389034 400 │ │ │ │ │ +[1] 389046 400 │ │ │ │ │ │ │ │ │ │ $variables$homoPS │ │ │ │ │ -[1] 389434 399 │ │ │ │ │ +[1] 389446 399 │ │ │ │ │ │ │ │ │ │ $variables$homoType │ │ │ │ │ -[1] 389833 399 │ │ │ │ │ +[1] 389845 399 │ │ │ │ │ │ │ │ │ │ $variables$homoURL │ │ │ │ │ -[1] 390232 400 │ │ │ │ │ +[1] 390244 400 │ │ │ │ │ │ │ │ │ │ $variables$htmlpage │ │ │ │ │ -[1] 390632 3148 │ │ │ │ │ +[1] 390644 3148 │ │ │ │ │ │ │ │ │ │ $variables$isValidKey │ │ │ │ │ -[1] 393780 425 │ │ │ │ │ +[1] 393792 425 │ │ │ │ │ │ │ │ │ │ $variables$journal │ │ │ │ │ -[1] 394205 400 │ │ │ │ │ +[1] 394217 400 │ │ │ │ │ │ │ │ │ │ $variables$lookUp │ │ │ │ │ -[1] 394605 546 │ │ │ │ │ +[1] 394617 546 │ │ │ │ │ │ │ │ │ │ $variables$mainPage │ │ │ │ │ -[1] 395151 414 │ │ │ │ │ +[1] 395163 414 │ │ │ │ │ │ │ │ │ │ $variables$makeAnchor │ │ │ │ │ -[1] 395565 502 │ │ │ │ │ +[1] 395577 502 │ │ │ │ │ │ │ │ │ │ $variables$mapOrgs │ │ │ │ │ -[1] 396067 960 │ │ │ │ │ +[1] 396079 960 │ │ │ │ │ │ │ │ │ │ $variables$nChrom │ │ │ │ │ -[1] 397027 400 │ │ │ │ │ +[1] 397039 400 │ │ │ │ │ │ │ │ │ │ $variables$pageText │ │ │ │ │ -[1] 397427 414 │ │ │ │ │ +[1] 397439 414 │ │ │ │ │ │ │ │ │ │ $variables$pageTitle │ │ │ │ │ -[1] 397841 417 │ │ │ │ │ +[1] 397853 417 │ │ │ │ │ │ │ │ │ │ $variables$pm.abstGrep │ │ │ │ │ -[1] 398258 772 │ │ │ │ │ +[1] 398270 772 │ │ │ │ │ │ │ │ │ │ $variables$pm.getabst │ │ │ │ │ -[1] 399030 1352 │ │ │ │ │ +[1] 399042 1352 │ │ │ │ │ │ │ │ │ │ $variables$pm.titles │ │ │ │ │ -[1] 400382 699 │ │ │ │ │ +[1] 400394 699 │ │ │ │ │ │ │ │ │ │ $variables$pmAbst2HTML │ │ │ │ │ -[1] 401081 3908 │ │ │ │ │ +[1] 401093 3908 │ │ │ │ │ │ │ │ │ │ $variables$pmid │ │ │ │ │ -[1] 404989 398 │ │ │ │ │ +[1] 405001 398 │ │ │ │ │ │ │ │ │ │ $variables$pmid2MIAME │ │ │ │ │ -[1] 405387 1581 │ │ │ │ │ +[1] 405399 1581 │ │ │ │ │ │ │ │ │ │ $variables$pmidQuery │ │ │ │ │ -[1] 406968 631 │ │ │ │ │ +[1] 406980 631 │ │ │ │ │ │ │ │ │ │ $variables$probesToChrom │ │ │ │ │ -[1] 407599 406 │ │ │ │ │ +[1] 407611 406 │ │ │ │ │ │ │ │ │ │ $variables$pubDate │ │ │ │ │ -[1] 408005 400 │ │ │ │ │ +[1] 408017 400 │ │ │ │ │ │ │ │ │ │ $variables$pubMedAbst │ │ │ │ │ -[1] 408405 406 │ │ │ │ │ +[1] 408417 406 │ │ │ │ │ │ │ │ │ │ $variables$pubmed │ │ │ │ │ -[1] 408811 1372 │ │ │ │ │ +[1] 408823 1372 │ │ │ │ │ │ │ │ │ │ $variables$readGEOAnn │ │ │ │ │ -[1] 410183 917 │ │ │ │ │ +[1] 410195 917 │ │ │ │ │ │ │ │ │ │ $variables$readIDNAcc │ │ │ │ │ -[1] 411100 421 │ │ │ │ │ +[1] 411112 421 │ │ │ │ │ │ │ │ │ │ $variables$readUrl │ │ │ │ │ -[1] 411521 712 │ │ │ │ │ +[1] 411533 712 │ │ │ │ │ │ │ │ │ │ $variables$serializeDataPkgEnvs │ │ │ │ │ -[1] 412233 1804 │ │ │ │ │ +[1] 412245 1804 │ │ │ │ │ │ │ │ │ │ $variables$serializeEnv │ │ │ │ │ -[1] 414037 1506 │ │ │ │ │ +[1] 414049 1506 │ │ │ │ │ │ │ │ │ │ $variables$setRepository │ │ │ │ │ -[1] 415543 522 │ │ │ │ │ +[1] 415555 522 │ │ │ │ │ │ │ │ │ │ $variables$sidePage │ │ │ │ │ -[1] 416065 415 │ │ │ │ │ +[1] 416077 415 │ │ │ │ │ │ │ │ │ │ $variables$toFile │ │ │ │ │ -[1] 416480 414 │ │ │ │ │ +[1] 416492 414 │ │ │ │ │ │ │ │ │ │ $variables$topPage │ │ │ │ │ -[1] 416894 415 │ │ │ │ │ +[1] 416906 415 │ │ │ │ │ │ │ │ │ │ $variables$updateSymbolsToValidKeys │ │ │ │ │ -[1] 417309 2459 │ │ │ │ │ +[1] 417321 2459 │ │ │ │ │ │ │ │ │ │ $variables$usedChromGenes │ │ │ │ │ -[1] 419768 693 │ │ │ │ │ +[1] 419780 693 │ │ │ │ │ │ │ │ │ │ $variables$weightByConfi │ │ │ │ │ -[1] 420461 951 │ │ │ │ │ +[1] 420473 951 │ │ │ │ │ │ │ │ │ │ $variables$whatACC │ │ │ │ │ -[1] 421412 939 │ │ │ │ │ +[1] 421424 939 │ │ │ │ │ │ │ │ │ │ │ │ │ │ │ $references │ │ │ │ │ $references$`env::1` │ │ │ │ │ -[1] 3790 5318 │ │ │ │ │ +[1] 3790 5330 │ │ │ │ │ │ │ │ │ │ $references$`env::10` │ │ │ │ │ -[1] 18947 270 │ │ │ │ │ +[1] 18959 270 │ │ │ │ │ │ │ │ │ │ $references$`env::100` │ │ │ │ │ -[1] 83673 159 │ │ │ │ │ +[1] 83685 159 │ │ │ │ │ │ │ │ │ │ $references$`env::101` │ │ │ │ │ -[1] 78039 5634 │ │ │ │ │ +[1] 78051 5634 │ │ │ │ │ │ │ │ │ │ $references$`env::102` │ │ │ │ │ -[1] 92206 143 │ │ │ │ │ +[1] 92218 143 │ │ │ │ │ │ │ │ │ │ $references$`env::103` │ │ │ │ │ -[1] 87073 5133 │ │ │ │ │ +[1] 87085 5133 │ │ │ │ │ │ │ │ │ │ $references$`env::104` │ │ │ │ │ -[1] 86345 728 │ │ │ │ │ +[1] 86357 728 │ │ │ │ │ │ │ │ │ │ $references$`env::105` │ │ │ │ │ -[1] 94829 4846 │ │ │ │ │ +[1] 94841 4846 │ │ │ │ │ │ │ │ │ │ $references$`env::106` │ │ │ │ │ -[1] 99675 308 │ │ │ │ │ +[1] 99687 308 │ │ │ │ │ │ │ │ │ │ $references$`env::107` │ │ │ │ │ -[1] 143773 30459 │ │ │ │ │ +[1] 143785 30459 │ │ │ │ │ │ │ │ │ │ $references$`env::108` │ │ │ │ │ -[1] 183638 1593 │ │ │ │ │ +[1] 183650 1593 │ │ │ │ │ │ │ │ │ │ $references$`env::109` │ │ │ │ │ -[1] 183377 261 │ │ │ │ │ +[1] 183389 261 │ │ │ │ │ │ │ │ │ │ $references$`env::11` │ │ │ │ │ -[1] 14119 2414 │ │ │ │ │ +[1] 14131 2414 │ │ │ │ │ │ │ │ │ │ $references$`env::110` │ │ │ │ │ -[1] 180191 1593 │ │ │ │ │ +[1] 180203 1593 │ │ │ │ │ │ │ │ │ │ $references$`env::111` │ │ │ │ │ -[1] 181784 1593 │ │ │ │ │ +[1] 181796 1593 │ │ │ │ │ │ │ │ │ │ $references$`env::112` │ │ │ │ │ -[1] 186281 368 │ │ │ │ │ +[1] 186293 368 │ │ │ │ │ │ │ │ │ │ $references$`env::113` │ │ │ │ │ -[1] 186021 260 │ │ │ │ │ +[1] 186033 260 │ │ │ │ │ │ │ │ │ │ $references$`env::114` │ │ │ │ │ -[1] 185285 368 │ │ │ │ │ +[1] 185297 368 │ │ │ │ │ │ │ │ │ │ $references$`env::115` │ │ │ │ │ -[1] 185653 368 │ │ │ │ │ +[1] 185665 368 │ │ │ │ │ │ │ │ │ │ $references$`env::116` │ │ │ │ │ -[1] 187714 378 │ │ │ │ │ +[1] 187726 378 │ │ │ │ │ │ │ │ │ │ $references$`env::117` │ │ │ │ │ -[1] 187459 255 │ │ │ │ │ +[1] 187471 255 │ │ │ │ │ │ │ │ │ │ $references$`env::118` │ │ │ │ │ -[1] 186703 378 │ │ │ │ │ +[1] 186715 378 │ │ │ │ │ │ │ │ │ │ $references$`env::119` │ │ │ │ │ -[1] 187081 378 │ │ │ │ │ +[1] 187093 378 │ │ │ │ │ │ │ │ │ │ $references$`env::12` │ │ │ │ │ -[1] 16533 2414 │ │ │ │ │ +[1] 16545 2414 │ │ │ │ │ │ │ │ │ │ $references$`env::120` │ │ │ │ │ -[1] 189228 411 │ │ │ │ │ +[1] 189240 411 │ │ │ │ │ │ │ │ │ │ $references$`env::121` │ │ │ │ │ -[1] 188968 260 │ │ │ │ │ +[1] 188980 260 │ │ │ │ │ │ │ │ │ │ $references$`env::122` │ │ │ │ │ -[1] 188146 411 │ │ │ │ │ +[1] 188158 411 │ │ │ │ │ │ │ │ │ │ $references$`env::123` │ │ │ │ │ -[1] 188557 411 │ │ │ │ │ +[1] 188569 411 │ │ │ │ │ │ │ │ │ │ $references$`env::124` │ │ │ │ │ -[1] 191241 573 │ │ │ │ │ +[1] 191253 573 │ │ │ │ │ │ │ │ │ │ $references$`env::125` │ │ │ │ │ -[1] 190981 260 │ │ │ │ │ +[1] 190993 260 │ │ │ │ │ │ │ │ │ │ $references$`env::126` │ │ │ │ │ -[1] 189693 644 │ │ │ │ │ +[1] 189705 644 │ │ │ │ │ │ │ │ │ │ $references$`env::127` │ │ │ │ │ -[1] 190337 644 │ │ │ │ │ +[1] 190349 644 │ │ │ │ │ │ │ │ │ │ $references$`env::128` │ │ │ │ │ -[1] 192872 374 │ │ │ │ │ +[1] 192884 374 │ │ │ │ │ │ │ │ │ │ $references$`env::129` │ │ │ │ │ -[1] 192616 256 │ │ │ │ │ +[1] 192628 256 │ │ │ │ │ │ │ │ │ │ $references$`env::13` │ │ │ │ │ -[1] 22673 366 │ │ │ │ │ +[1] 22685 366 │ │ │ │ │ │ │ │ │ │ $references$`env::130` │ │ │ │ │ -[1] 191868 374 │ │ │ │ │ +[1] 191880 374 │ │ │ │ │ │ │ │ │ │ $references$`env::131` │ │ │ │ │ -[1] 192242 374 │ │ │ │ │ +[1] 192254 374 │ │ │ │ │ │ │ │ │ │ $references$`env::132` │ │ │ │ │ -[1] 194309 375 │ │ │ │ │ +[1] 194321 375 │ │ │ │ │ │ │ │ │ │ $references$`env::133` │ │ │ │ │ -[1] 194050 259 │ │ │ │ │ +[1] 194062 259 │ │ │ │ │ │ │ │ │ │ $references$`env::134` │ │ │ │ │ -[1] 193300 375 │ │ │ │ │ +[1] 193312 375 │ │ │ │ │ │ │ │ │ │ $references$`env::135` │ │ │ │ │ -[1] 193675 375 │ │ │ │ │ +[1] 193687 375 │ │ │ │ │ │ │ │ │ │ $references$`env::136` │ │ │ │ │ -[1] 195728 366 │ │ │ │ │ +[1] 195740 366 │ │ │ │ │ │ │ │ │ │ $references$`env::137` │ │ │ │ │ -[1] 195470 258 │ │ │ │ │ +[1] 195482 258 │ │ │ │ │ │ │ │ │ │ $references$`env::138` │ │ │ │ │ -[1] 194738 366 │ │ │ │ │ +[1] 194750 366 │ │ │ │ │ │ │ │ │ │ $references$`env::139` │ │ │ │ │ -[1] 195104 366 │ │ │ │ │ +[1] 195116 366 │ │ │ │ │ │ │ │ │ │ $references$`env::14` │ │ │ │ │ -[1] 22415 258 │ │ │ │ │ +[1] 22427 258 │ │ │ │ │ │ │ │ │ │ $references$`env::140` │ │ │ │ │ -[1] 197160 374 │ │ │ │ │ +[1] 197172 374 │ │ │ │ │ │ │ │ │ │ $references$`env::141` │ │ │ │ │ -[1] 196896 264 │ │ │ │ │ +[1] 196908 264 │ │ │ │ │ │ │ │ │ │ $references$`env::142` │ │ │ │ │ -[1] 196148 374 │ │ │ │ │ +[1] 196160 374 │ │ │ │ │ │ │ │ │ │ $references$`env::143` │ │ │ │ │ -[1] 196522 374 │ │ │ │ │ +[1] 196534 374 │ │ │ │ │ │ │ │ │ │ $references$`env::144` │ │ │ │ │ -[1] 198584 368 │ │ │ │ │ +[1] 198596 368 │ │ │ │ │ │ │ │ │ │ $references$`env::145` │ │ │ │ │ -[1] 198324 260 │ │ │ │ │ +[1] 198336 260 │ │ │ │ │ │ │ │ │ │ $references$`env::146` │ │ │ │ │ -[1] 197588 368 │ │ │ │ │ +[1] 197600 368 │ │ │ │ │ │ │ │ │ │ $references$`env::147` │ │ │ │ │ -[1] 197956 368 │ │ │ │ │ +[1] 197968 368 │ │ │ │ │ │ │ │ │ │ $references$`env::148` │ │ │ │ │ -[1] 199551 143 │ │ │ │ │ +[1] 199563 143 │ │ │ │ │ │ │ │ │ │ $references$`env::149` │ │ │ │ │ -[1] 199292 259 │ │ │ │ │ +[1] 199304 259 │ │ │ │ │ │ │ │ │ │ $references$`env::15` │ │ │ │ │ -[1] 21683 366 │ │ │ │ │ +[1] 21695 366 │ │ │ │ │ │ │ │ │ │ $references$`env::150` │ │ │ │ │ -[1] 199006 143 │ │ │ │ │ +[1] 199018 143 │ │ │ │ │ │ │ │ │ │ $references$`env::151` │ │ │ │ │ -[1] 199149 143 │ │ │ │ │ +[1] 199161 143 │ │ │ │ │ │ │ │ │ │ $references$`env::152` │ │ │ │ │ -[1] 277804 3347 │ │ │ │ │ +[1] 277816 3347 │ │ │ │ │ │ │ │ │ │ $references$`env::153` │ │ │ │ │ -[1] 277344 460 │ │ │ │ │ +[1] 277356 460 │ │ │ │ │ │ │ │ │ │ $references$`env::154` │ │ │ │ │ -[1] 199918 38713 │ │ │ │ │ +[1] 199930 38713 │ │ │ │ │ │ │ │ │ │ $references$`env::155` │ │ │ │ │ -[1] 199748 170 │ │ │ │ │ +[1] 199760 170 │ │ │ │ │ │ │ │ │ │ $references$`env::156` │ │ │ │ │ -[1] 238631 38713 │ │ │ │ │ +[1] 238643 38713 │ │ │ │ │ │ │ │ │ │ $references$`env::157` │ │ │ │ │ -[1] 282217 378 │ │ │ │ │ +[1] 282229 378 │ │ │ │ │ │ │ │ │ │ $references$`env::158` │ │ │ │ │ -[1] 281961 256 │ │ │ │ │ +[1] 281973 256 │ │ │ │ │ │ │ │ │ │ $references$`env::159` │ │ │ │ │ -[1] 281205 378 │ │ │ │ │ +[1] 281217 378 │ │ │ │ │ │ │ │ │ │ $references$`env::16` │ │ │ │ │ -[1] 22049 366 │ │ │ │ │ +[1] 22061 366 │ │ │ │ │ │ │ │ │ │ $references$`env::160` │ │ │ │ │ -[1] 281583 378 │ │ │ │ │ +[1] 281595 378 │ │ │ │ │ │ │ │ │ │ $references$`env::161` │ │ │ │ │ -[1] 284420 756 │ │ │ │ │ +[1] 284432 756 │ │ │ │ │ │ │ │ │ │ $references$`env::162` │ │ │ │ │ -[1] 284161 259 │ │ │ │ │ +[1] 284173 259 │ │ │ │ │ │ │ │ │ │ $references$`env::163` │ │ │ │ │ -[1] 282649 756 │ │ │ │ │ +[1] 282661 756 │ │ │ │ │ │ │ │ │ │ $references$`env::164` │ │ │ │ │ -[1] 283405 756 │ │ │ │ │ +[1] 283417 756 │ │ │ │ │ │ │ │ │ │ $references$`env::165` │ │ │ │ │ -[1] 286246 378 │ │ │ │ │ +[1] 286258 378 │ │ │ │ │ │ │ │ │ │ $references$`env::166` │ │ │ │ │ -[1] 285986 260 │ │ │ │ │ +[1] 285998 260 │ │ │ │ │ │ │ │ │ │ $references$`env::167` │ │ │ │ │ -[1] 285230 378 │ │ │ │ │ +[1] 285242 378 │ │ │ │ │ │ │ │ │ │ $references$`env::168` │ │ │ │ │ -[1] 285608 378 │ │ │ │ │ +[1] 285620 378 │ │ │ │ │ │ │ │ │ │ $references$`env::169` │ │ │ │ │ -[1] 294858 131 │ │ │ │ │ +[1] 294870 131 │ │ │ │ │ │ │ │ │ │ $references$`env::17` │ │ │ │ │ -[1] 26084 1364 │ │ │ │ │ +[1] 26096 1364 │ │ │ │ │ │ │ │ │ │ $references$`env::18` │ │ │ │ │ -[1] 25820 264 │ │ │ │ │ +[1] 25832 264 │ │ │ │ │ │ │ │ │ │ $references$`env::19` │ │ │ │ │ -[1] 23092 1364 │ │ │ │ │ +[1] 23104 1364 │ │ │ │ │ │ │ │ │ │ $references$`env::2` │ │ │ │ │ [1] 3501 131 │ │ │ │ │ │ │ │ │ │ $references$`env::20` │ │ │ │ │ -[1] 24456 1364 │ │ │ │ │ +[1] 24468 1364 │ │ │ │ │ │ │ │ │ │ $references$`env::21` │ │ │ │ │ -[1] 28500 370 │ │ │ │ │ +[1] 28512 370 │ │ │ │ │ │ │ │ │ │ $references$`env::22` │ │ │ │ │ -[1] 28241 259 │ │ │ │ │ +[1] 28253 259 │ │ │ │ │ │ │ │ │ │ $references$`env::23` │ │ │ │ │ -[1] 27501 370 │ │ │ │ │ +[1] 27513 370 │ │ │ │ │ │ │ │ │ │ $references$`env::24` │ │ │ │ │ -[1] 27871 370 │ │ │ │ │ +[1] 27883 370 │ │ │ │ │ │ │ │ │ │ $references$`env::25` │ │ │ │ │ -[1] 29915 367 │ │ │ │ │ +[1] 29927 367 │ │ │ │ │ │ │ │ │ │ $references$`env::26` │ │ │ │ │ -[1] 29657 258 │ │ │ │ │ +[1] 29669 258 │ │ │ │ │ │ │ │ │ │ $references$`env::27` │ │ │ │ │ -[1] 28923 367 │ │ │ │ │ +[1] 28935 367 │ │ │ │ │ │ │ │ │ │ $references$`env::28` │ │ │ │ │ -[1] 29290 367 │ │ │ │ │ +[1] 29302 367 │ │ │ │ │ │ │ │ │ │ $references$`env::29` │ │ │ │ │ -[1] 31332 368 │ │ │ │ │ +[1] 31344 368 │ │ │ │ │ │ │ │ │ │ $references$`env::3` │ │ │ │ │ [1] 3632 158 │ │ │ │ │ │ │ │ │ │ $references$`env::30` │ │ │ │ │ -[1] 31071 261 │ │ │ │ │ +[1] 31083 261 │ │ │ │ │ │ │ │ │ │ $references$`env::31` │ │ │ │ │ -[1] 30335 368 │ │ │ │ │ +[1] 30347 368 │ │ │ │ │ │ │ │ │ │ $references$`env::32` │ │ │ │ │ -[1] 30703 368 │ │ │ │ │ +[1] 30715 368 │ │ │ │ │ │ │ │ │ │ $references$`env::33` │ │ │ │ │ -[1] 33210 599 │ │ │ │ │ +[1] 33222 599 │ │ │ │ │ │ │ │ │ │ $references$`env::34` │ │ │ │ │ -[1] 32951 259 │ │ │ │ │ +[1] 32963 259 │ │ │ │ │ │ │ │ │ │ $references$`env::35` │ │ │ │ │ -[1] 31753 599 │ │ │ │ │ +[1] 31765 599 │ │ │ │ │ │ │ │ │ │ $references$`env::36` │ │ │ │ │ -[1] 32352 599 │ │ │ │ │ +[1] 32364 599 │ │ │ │ │ │ │ │ │ │ $references$`env::37` │ │ │ │ │ -[1] 34855 366 │ │ │ │ │ +[1] 34867 366 │ │ │ │ │ │ │ │ │ │ $references$`env::38` │ │ │ │ │ -[1] 34594 261 │ │ │ │ │ +[1] 34606 261 │ │ │ │ │ │ │ │ │ │ $references$`env::39` │ │ │ │ │ -[1] 33862 366 │ │ │ │ │ +[1] 33874 366 │ │ │ │ │ │ │ │ │ │ $references$`env::4` │ │ │ │ │ -[1] 9160 131 │ │ │ │ │ +[1] 9172 131 │ │ │ │ │ │ │ │ │ │ $references$`env::40` │ │ │ │ │ -[1] 34228 366 │ │ │ │ │ +[1] 34240 366 │ │ │ │ │ │ │ │ │ │ $references$`env::41` │ │ │ │ │ -[1] 36346 407 │ │ │ │ │ +[1] 36358 407 │ │ │ │ │ │ │ │ │ │ $references$`env::42` │ │ │ │ │ -[1] 36088 258 │ │ │ │ │ +[1] 36100 258 │ │ │ │ │ │ │ │ │ │ $references$`env::43` │ │ │ │ │ -[1] 35274 407 │ │ │ │ │ +[1] 35286 407 │ │ │ │ │ │ │ │ │ │ $references$`env::44` │ │ │ │ │ -[1] 35681 407 │ │ │ │ │ +[1] 35693 407 │ │ │ │ │ │ │ │ │ │ $references$`env::45` │ │ │ │ │ -[1] 37803 370 │ │ │ │ │ +[1] 37815 370 │ │ │ │ │ │ │ │ │ │ $references$`env::46` │ │ │ │ │ -[1] 37546 257 │ │ │ │ │ +[1] 37558 257 │ │ │ │ │ │ │ │ │ │ $references$`env::47` │ │ │ │ │ -[1] 36806 370 │ │ │ │ │ +[1] 36818 370 │ │ │ │ │ │ │ │ │ │ $references$`env::48` │ │ │ │ │ -[1] 37176 370 │ │ │ │ │ +[1] 37188 370 │ │ │ │ │ │ │ │ │ │ $references$`env::49` │ │ │ │ │ -[1] 39248 382 │ │ │ │ │ +[1] 39260 382 │ │ │ │ │ │ │ │ │ │ $references$`env::5` │ │ │ │ │ -[1] 12581 1486 │ │ │ │ │ +[1] 12593 1486 │ │ │ │ │ │ │ │ │ │ $references$`env::50` │ │ │ │ │ -[1] 38990 258 │ │ │ │ │ +[1] 39002 258 │ │ │ │ │ │ │ │ │ │ $references$`env::51` │ │ │ │ │ -[1] 38226 382 │ │ │ │ │ +[1] 38238 382 │ │ │ │ │ │ │ │ │ │ $references$`env::52` │ │ │ │ │ -[1] 38608 382 │ │ │ │ │ +[1] 38620 382 │ │ │ │ │ │ │ │ │ │ $references$`env::53` │ │ │ │ │ -[1] 40688 372 │ │ │ │ │ +[1] 40700 372 │ │ │ │ │ │ │ │ │ │ $references$`env::54` │ │ │ │ │ -[1] 40427 261 │ │ │ │ │ +[1] 40439 261 │ │ │ │ │ │ │ │ │ │ $references$`env::55` │ │ │ │ │ -[1] 39683 372 │ │ │ │ │ +[1] 39695 372 │ │ │ │ │ │ │ │ │ │ $references$`env::56` │ │ │ │ │ -[1] 40055 372 │ │ │ │ │ +[1] 40067 372 │ │ │ │ │ │ │ │ │ │ $references$`env::57` │ │ │ │ │ -[1] 42102 365 │ │ │ │ │ +[1] 42114 365 │ │ │ │ │ │ │ │ │ │ $references$`env::58` │ │ │ │ │ -[1] 41843 259 │ │ │ │ │ +[1] 41855 259 │ │ │ │ │ │ │ │ │ │ $references$`env::59` │ │ │ │ │ -[1] 41113 365 │ │ │ │ │ +[1] 41125 365 │ │ │ │ │ │ │ │ │ │ $references$`env::6` │ │ │ │ │ -[1] 12315 266 │ │ │ │ │ +[1] 12327 266 │ │ │ │ │ │ │ │ │ │ $references$`env::60` │ │ │ │ │ -[1] 41478 365 │ │ │ │ │ +[1] 41490 365 │ │ │ │ │ │ │ │ │ │ $references$`env::61` │ │ │ │ │ -[1] 43512 366 │ │ │ │ │ +[1] 43524 366 │ │ │ │ │ │ │ │ │ │ $references$`env::62` │ │ │ │ │ -[1] 43252 260 │ │ │ │ │ +[1] 43264 260 │ │ │ │ │ │ │ │ │ │ $references$`env::63` │ │ │ │ │ -[1] 42520 366 │ │ │ │ │ +[1] 42532 366 │ │ │ │ │ │ │ │ │ │ $references$`env::64` │ │ │ │ │ -[1] 42886 366 │ │ │ │ │ +[1] 42898 366 │ │ │ │ │ │ │ │ │ │ $references$`env::65` │ │ │ │ │ -[1] 44915 363 │ │ │ │ │ +[1] 44927 363 │ │ │ │ │ │ │ │ │ │ $references$`env::66` │ │ │ │ │ -[1] 44657 258 │ │ │ │ │ +[1] 44669 258 │ │ │ │ │ │ │ │ │ │ $references$`env::67` │ │ │ │ │ -[1] 43931 363 │ │ │ │ │ +[1] 43943 363 │ │ │ │ │ │ │ │ │ │ $references$`env::68` │ │ │ │ │ -[1] 44294 363 │ │ │ │ │ +[1] 44306 363 │ │ │ │ │ │ │ │ │ │ $references$`env::69` │ │ │ │ │ -[1] 46320 365 │ │ │ │ │ +[1] 46332 365 │ │ │ │ │ │ │ │ │ │ $references$`env::7` │ │ │ │ │ -[1] 9343 1486 │ │ │ │ │ +[1] 9355 1486 │ │ │ │ │ │ │ │ │ │ $references$`env::70` │ │ │ │ │ -[1] 46061 259 │ │ │ │ │ +[1] 46073 259 │ │ │ │ │ │ │ │ │ │ $references$`env::71` │ │ │ │ │ -[1] 45331 365 │ │ │ │ │ +[1] 45343 365 │ │ │ │ │ │ │ │ │ │ $references$`env::72` │ │ │ │ │ -[1] 45696 365 │ │ │ │ │ +[1] 45708 365 │ │ │ │ │ │ │ │ │ │ $references$`env::73` │ │ │ │ │ -[1] 47722 363 │ │ │ │ │ +[1] 47734 363 │ │ │ │ │ │ │ │ │ │ $references$`env::74` │ │ │ │ │ -[1] 47464 258 │ │ │ │ │ +[1] 47476 258 │ │ │ │ │ │ │ │ │ │ $references$`env::75` │ │ │ │ │ -[1] 46738 363 │ │ │ │ │ +[1] 46750 363 │ │ │ │ │ │ │ │ │ │ $references$`env::76` │ │ │ │ │ -[1] 47101 363 │ │ │ │ │ +[1] 47113 363 │ │ │ │ │ │ │ │ │ │ $references$`env::77` │ │ │ │ │ -[1] 49126 364 │ │ │ │ │ +[1] 49138 364 │ │ │ │ │ │ │ │ │ │ $references$`env::78` │ │ │ │ │ -[1] 48866 260 │ │ │ │ │ +[1] 48878 260 │ │ │ │ │ │ │ │ │ │ $references$`env::79` │ │ │ │ │ -[1] 48138 364 │ │ │ │ │ +[1] 48150 364 │ │ │ │ │ │ │ │ │ │ $references$`env::8` │ │ │ │ │ -[1] 10829 1486 │ │ │ │ │ +[1] 10841 1486 │ │ │ │ │ │ │ │ │ │ $references$`env::80` │ │ │ │ │ -[1] 48502 364 │ │ │ │ │ +[1] 48514 364 │ │ │ │ │ │ │ │ │ │ $references$`env::81` │ │ │ │ │ -[1] 50534 366 │ │ │ │ │ +[1] 50546 366 │ │ │ │ │ │ │ │ │ │ $references$`env::82` │ │ │ │ │ -[1] 50275 259 │ │ │ │ │ +[1] 50287 259 │ │ │ │ │ │ │ │ │ │ $references$`env::83` │ │ │ │ │ -[1] 49543 366 │ │ │ │ │ +[1] 49555 366 │ │ │ │ │ │ │ │ │ │ $references$`env::84` │ │ │ │ │ -[1] 49909 366 │ │ │ │ │ +[1] 49921 366 │ │ │ │ │ │ │ │ │ │ $references$`env::85` │ │ │ │ │ -[1] 178993 1145 │ │ │ │ │ +[1] 179005 1145 │ │ │ │ │ │ │ │ │ │ $references$`env::86` │ │ │ │ │ -[1] 174232 4761 │ │ │ │ │ +[1] 174244 4761 │ │ │ │ │ │ │ │ │ │ $references$`env::87` │ │ │ │ │ -[1] 99983 43790 │ │ │ │ │ +[1] 99995 43790 │ │ │ │ │ │ │ │ │ │ $references$`env::88` │ │ │ │ │ -[1] 67929 336 │ │ │ │ │ +[1] 67941 336 │ │ │ │ │ │ │ │ │ │ $references$`env::89` │ │ │ │ │ -[1] 60924 7005 │ │ │ │ │ +[1] 60936 7005 │ │ │ │ │ │ │ │ │ │ $references$`env::9` │ │ │ │ │ -[1] 19217 2414 │ │ │ │ │ +[1] 19229 2414 │ │ │ │ │ │ │ │ │ │ $references$`env::90` │ │ │ │ │ -[1] 59690 143 │ │ │ │ │ +[1] 59702 143 │ │ │ │ │ │ │ │ │ │ $references$`env::91` │ │ │ │ │ -[1] 50953 8737 │ │ │ │ │ +[1] 50965 8737 │ │ │ │ │ │ │ │ │ │ $references$`env::92` │ │ │ │ │ -[1] 59833 1091 │ │ │ │ │ +[1] 59845 1091 │ │ │ │ │ │ │ │ │ │ $references$`env::93` │ │ │ │ │ -[1] 68265 2268 │ │ │ │ │ +[1] 68277 2268 │ │ │ │ │ │ │ │ │ │ $references$`env::94` │ │ │ │ │ -[1] 70533 1516 │ │ │ │ │ +[1] 70545 1516 │ │ │ │ │ │ │ │ │ │ $references$`env::95` │ │ │ │ │ -[1] 92349 2480 │ │ │ │ │ +[1] 92361 2480 │ │ │ │ │ │ │ │ │ │ $references$`env::96` │ │ │ │ │ -[1] 77896 143 │ │ │ │ │ +[1] 77908 143 │ │ │ │ │ │ │ │ │ │ $references$`env::97` │ │ │ │ │ -[1] 72771 5125 │ │ │ │ │ +[1] 72783 5125 │ │ │ │ │ │ │ │ │ │ $references$`env::98` │ │ │ │ │ -[1] 72049 722 │ │ │ │ │ +[1] 72061 722 │ │ │ │ │ │ │ │ │ │ $references$`env::99` │ │ │ │ │ -[1] 83832 2513 │ │ │ │ │ +[1] 83844 2513 │ │ │ │ │ │ │ │ │ │ │ │ │ │ │ $compressed │ │ │ │ │ [1] TRUE │ │ ├── ./usr/lib/R/site-library/annotate/help/annotate.rdb │ │ │ ├── Rscript --vanilla - {} │ │ │ │ @@ -28,15 +28,15 @@ │ │ │ │ structure(" ids can be of different types of public ids, such as GenBank Accession\n", Rd_tag = "TEXT"), │ │ │ │ structure(" number, UniGene ids, etc..\n", Rd_tag = "TEXT"), │ │ │ │ structure("\n", Rd_tag = "TEXT"), structure(" ACCNUMStats counts the number of probes that are mapped to different\n", Rd_tag = "TEXT"), │ │ │ │ structure(" types of public ids and have the results presented in a table.\n", Rd_tag = "TEXT")), Rd_tag = "\\details"), │ │ │ │ structure(list(structure("Jianhua Zhang", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure("The ACCNUM environment of a platform dependent BioC data package", Rd_tag = "TEXT")), Rd_tag = "\\references"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"hgu95av2.db\")\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" ACCNUMStats(\"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/ACCNUMStats.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" ACCNUMStats(\"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/ACCNUMStats.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ GO2heatmap (list) = structure(list(structure(list(structure("Compute a heatmap for the specified data, for either a GO\n", Rd_tag = "TEXT"), │ │ │ │ structure(" category or a KEGG pathway.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("GO2heatmap", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("GO2heatmap", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("KEGG2heatmap", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -80,15 +80,15 @@ │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" The value returned by ", Rd_tag = "TEXT"), │ │ │ │ structure(list(structure("heatmap", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(" is passed back to the user.\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("R. Gentleman ", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure(list(structure(list(structure("heatmap", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"hgu95av2.db\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" data(sample.ExpressionSet)\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" KEGG2heatmap(\"04810\", sample.ExpressionSet, \"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/GO2heatmap.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" KEGG2heatmap(\"04810\", sample.ExpressionSet, \"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/GO2heatmap.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ GOmnplot (list) = structure(list(structure(list(structure("A function to plot by group means against each other.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("GOmnplot", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("GOmnplot", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("KEGGmnplot", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("KEGGmnplot,character,eSet,character-method", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -132,15 +132,15 @@ │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure("The matrix of per group means, for each probe.\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("R. Gentleman", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure(" ", Rd_tag = "TEXT"), structure(list( │ │ │ │ structure(list(structure("KEGG2heatmap", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"hgu95av2.db\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" data(sample.ExpressionSet)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" KEGGmnplot(\"04810\", sample.ExpressionSet, sample.ExpressionSet$sex, \n", Rd_tag = "RCODE"), │ │ │ │ - structure(" data = \"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/GOmnplot.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" data = \"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/GOmnplot.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ HTMLPage-class (list) = structure(list(structure(list(structure("Classes to represent HTML pages", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("HTMLPage-class", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("HTMLPage-class", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("HTMLPage", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("FramedHTMLPage", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -242,15 +242,15 @@ │ │ │ │ structure(" out to the file designated by the fileName slot", Rd_tag = "TEXT"))), Rd_tag = "\\item"), │ │ │ │ structure("\n", Rd_tag = "TEXT"), structure(" ", Rd_tag = "TEXT")), Rd_tag = "\\describe"), │ │ │ │ structure("\n", Rd_tag = "TEXT"))), Rd_tag = "\\section"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" These classes are currently experimental.\n", Rd_tag = "TEXT"), │ │ │ │ structure("\n", Rd_tag = "TEXT"), structure(" FramedHTMLPage is modeled after the framing layout of the Bioconductor\n", Rd_tag = "TEXT"), │ │ │ │ structure(" website (www.bioconductor.org).\n", Rd_tag = "TEXT")), Rd_tag = "\\note"), │ │ │ │ structure(list(structure("Jeff Gentry", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ - structure(list(structure("\n", Rd_tag = "RCODE"), structure("##---- Should be DIRECTLY executable !! ----\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/HTMLPage-class.Rd", class = "Rd", meta = list( │ │ │ │ + structure(list(structure("\n", Rd_tag = "RCODE"), structure("##---- Should be DIRECTLY executable !! ----\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/HTMLPage-class.Rd", class = "Rd", meta = list( │ │ │ │ docType = "class", generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ LL2homology (list) = structure(list(structure(list(structure("DEFUNCT Functions that find the homology data for a given set of\n", Rd_tag = "TEXT"), │ │ │ │ structure(" LocusLink ids or HomoloGeneIDs", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("LL2homology", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("LL2homology", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("HGID2homology", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -319,15 +319,15 @@ │ │ │ │ structure(list(structure(list(structure("https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?=homologene", Rd_tag = "VERB")), Rd_tag = "\\url")), Rd_tag = "\\references"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(list( │ │ │ │ structure("\n", Rd_tag = "VERB"), structure(" ## hsahomology is a defunct package!\n", Rd_tag = "VERB"), │ │ │ │ structure(" if(require(\"hsahomology\")){\n", Rd_tag = "VERB"), │ │ │ │ structure(" llids <- ls(env = hsahomologyLL2HGID)[2:5]\n", Rd_tag = "VERB"), │ │ │ │ structure(" LL2homology(\"hsahomology\", llids)\n", Rd_tag = "VERB"), │ │ │ │ structure(" }\n", Rd_tag = "VERB"), structure("\n", Rd_tag = "VERB")), Rd_tag = "\\dontrun"), │ │ │ │ - structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/LL2homology.Rd", class = "Rd", meta = list( │ │ │ │ + structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/LL2homology.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ PMIDAmat (list) = structure(list(structure(list(structure("A function to compute the probe to PubMed id incidence matrix.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("PMIDAmat", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("PMIDAmat", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" For a given chip or a given set of genes, it computes the mapping from\n", Rd_tag = "TEXT"), │ │ │ │ @@ -351,15 +351,15 @@ │ │ │ │ structure(" process could finish soon. \n", Rd_tag = "TEXT"), │ │ │ │ structure(" ", Rd_tag = "TEXT")), Rd_tag = "\\details"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" A matrix containing zero or one, depending on whether the probe\n", Rd_tag = "TEXT"), │ │ │ │ structure(" (column) is associated with a PubMed id (row).\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("R. Gentleman", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"hgu95av2.db\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" probe <- names(as.list(hgu95av2ACCNUM))\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" Amat <- PMIDAmat(\"hgu95av2\", gene=sample(probe, 10))\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/PMIDAmat.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" Amat <- PMIDAmat(\"hgu95av2\", gene=sample(probe, 10))\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/PMIDAmat.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ PWAmat (list) = structure(list(structure(list(structure("A function to compute the probe to KEGG pathway incidence matrix.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("PWAmat", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("PWAmat", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" For a given chip we compute the mapping from probes to KEGG pathways.\n", Rd_tag = "TEXT")), Rd_tag = "\\description"), │ │ │ │ @@ -378,15 +378,15 @@ │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" A matrix containing zero or one, depending on whether the probe\n", Rd_tag = "TEXT"), │ │ │ │ structure(" (row) is in a pathway (column).\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("R. Gentleman", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure(list(structure(list(structure("KEGG2heatmap", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code"), │ │ │ │ structure(", ", Rd_tag = "TEXT"), structure(list(structure(list( │ │ │ │ structure("GOmnplot", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"hgu95av2.db\")\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" Am1 <- PWAmat(\"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/PWAmat.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" Am1 <- PWAmat(\"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/PWAmat.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ UniGeneQuery (list) = structure(list(structure(list(structure("Create a Query String for a UniGene Identifier ", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("UniGeneQuery", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("UniGeneQuery", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("interface", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure("Given a set of UniGene identifiers this function creates a set of URLs\n", Rd_tag = "TEXT"), │ │ │ │ @@ -412,15 +412,15 @@ │ │ │ │ structure(list(structure("Robert Gentleman", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure("NCBI, ", Rd_tag = "TEXT"), structure(list( │ │ │ │ structure("https://www.ncbi.nih.gov/", Rd_tag = "VERB")), Rd_tag = "\\url"), │ │ │ │ structure(" ", Rd_tag = "TEXT")), Rd_tag = "\\references"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" q1<-UniGeneQuery(c(\"Hs.293970\", \"Hs.155650\"))\n", Rd_tag = "RCODE"), │ │ │ │ structure(" q1\n", Rd_tag = "RCODE"), structure(" if( interactive())\n", Rd_tag = "RCODE"), │ │ │ │ structure(" browseURL(q1[1])\n", Rd_tag = "RCODE"), │ │ │ │ - structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/UniGeneQuery.Rd", class = "Rd", meta = list( │ │ │ │ + structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/UniGeneQuery.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ accessionToUID (list) = structure(list(structure(list(structure("A function to convert accession values to NCBI UIDs.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("accessionToUID", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("accessionToUID", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("interface", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" Given one or more accession values, this function will attempt to\n", Rd_tag = "TEXT"), │ │ │ │ @@ -447,15 +447,15 @@ │ │ │ │ structure("xmlTreeParse", Rd_tag = "TEXT")), Rd_tag = "\\link", Rd_option = structure("XML", Rd_tag = "TEXT"))), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure("\n", Rd_tag = "RCODE"), │ │ │ │ structure(" ## The two returns from genbank should be the same\n", Rd_tag = "RCODE"), │ │ │ │ structure(" xdoc <- genbank(\"U03397\",type=\"accession\",disp=\"data\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" x <- accessionToUID(\"U03397\",db=\"genbank\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" xdoc <- genbank(x, type=\"uid\",disp=\"data\")\n", Rd_tag = "RCODE"), │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure(" ## Can handle multiple inputs\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" y <- accessionToUID(\"M16653\",\"U892893\",db=\"genbank\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/accessionToUID.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" y <- accessionToUID(\"M16653\",\"U892893\",db=\"genbank\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/accessionToUID.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ annPkgName (list) = structure(list(structure(list(structure("Get annotation package name from chip name", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("annPkgName", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("annPkgName", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" This function returns the name of the Bioconductor annotation data\n", Rd_tag = "TEXT"), │ │ │ │ @@ -481,15 +481,15 @@ │ │ │ │ structure("\n", Rd_tag = "TEXT")), Rd_tag = "\\arguments"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" a string giving the name of the annotation data package\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("Seth Falcon", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" ", Rd_tag = "TEXT"), │ │ │ │ structure(list(structure(list(structure("getAnnMap", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code"), │ │ │ │ structure("\n", Rd_tag = "TEXT")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure("annPkgName(\"hgu133plus2\", type=\"db\")\n", Rd_tag = "RCODE"), │ │ │ │ - structure("annPkgName(\"hgu133plus2\", type=\"env\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/annPkgName.Rd", class = "Rd", meta = list( │ │ │ │ + structure("annPkgName(\"hgu133plus2\", type=\"env\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/annPkgName.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ aqListGOIDs (list) = structure(list(structure(list(structure("List GO Identifiers by GO Ontology", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("aqListGOIDs", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("aqListGOIDs", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" This function returns a character vector of all GO identifiers in the\n", Rd_tag = "TEXT"), │ │ │ │ @@ -514,15 +514,15 @@ │ │ │ │ structure(" argument.\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("Seth Falcon", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure("## all GO IDs in BP\n", Rd_tag = "RCODE"), │ │ │ │ structure("bp_ids = aqListGOIDs(\"BP\")\n", Rd_tag = "RCODE"), │ │ │ │ structure("length(bp_ids)\n", Rd_tag = "RCODE"), structure("\n", Rd_tag = "RCODE"), │ │ │ │ structure("## all GO IDs in BP or CC\n", Rd_tag = "RCODE"), │ │ │ │ structure("bp_or_cc_ids = aqListGOIDs(c(\"BP\", \"CC\"))\n", Rd_tag = "RCODE"), │ │ │ │ - structure("length(bp_or_cc_ids)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/aqListGOIDs.Rd", class = "Rd", meta = list( │ │ │ │ + structure("length(bp_or_cc_ids)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/aqListGOIDs.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ blastSequences (list) = structure(list(structure(list(structure("\n", Rd_tag = "TEXT"), │ │ │ │ structure(" Run a blast query to NCBI for either a string or an entrez gene ID and\n", Rd_tag = "TEXT"), │ │ │ │ structure(" then return a series of MultipleAlignment objects.\n", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("blastSequences", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("blastSequences", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -621,15 +621,15 @@ │ │ │ │ structure("blastSequences(17702, timeout=40, as=\"data.frame\")\n", Rd_tag = "RCODE"), │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure("if (interactive()) {\n", Rd_tag = "RCODE"), │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure(" ## or x can be a sequence\n", Rd_tag = "RCODE"), │ │ │ │ structure(" blastSequences(x = \"GGCCTTCATTTACCCAAAATG\")\n", Rd_tag = "RCODE"), │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure(" ## hitListSize does not promise that you will get the number of\n", Rd_tag = "RCODE"), │ │ │ │ structure(" ## matches you want.. It will just try to get that many.\n", Rd_tag = "RCODE"), │ │ │ │ structure(" blastSequences(x = \"GGCCTTCATTTACCCAAAATG\", hitListSize=\"20\")\n", Rd_tag = "RCODE"), │ │ │ │ - structure("\n", Rd_tag = "RCODE"), structure("}\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/blastSequences.Rd", class = "Rd", meta = list( │ │ │ │ + structure("\n", Rd_tag = "RCODE"), structure("}\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/blastSequences.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ buildChromLocation (list) = structure(list(structure(list(structure("A function to generate an instantiation of a chromLocation class", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("buildChromLocation", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("buildChromLocation", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("utilities", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" This function will take the name of a data package and build a\n", Rd_tag = "TEXT"), │ │ │ │ @@ -648,15 +648,15 @@ │ │ │ │ structure(list(structure("chromLocation", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(" object will\n", Rd_tag = "TEXT"), structure(" be created.\n", Rd_tag = "TEXT")), Rd_tag = "\\details"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" A ", Rd_tag = "TEXT"), │ │ │ │ structure(list(structure("chromLocation", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(" object representing the specified data set.\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("Jeff Gentry", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"hgu95av2.db\")\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" z <- buildChromLocation(\"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/buildChromLocation.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" z <- buildChromLocation(\"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/buildChromLocation.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ buildPubMedAbst (list) = structure(list(structure(list(structure("A function to generate an instantiation of a pubMedAbst class ", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("buildPubMedAbst", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("buildPubMedAbst", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure(" utilities ", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" This function will take in a XML tree object and will create an\n", Rd_tag = "TEXT"), │ │ │ │ @@ -674,15 +674,15 @@ │ │ │ │ structure("genbank", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" x <- pubmed(\"9695952\",\"8325638\",\"8422497\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" a <- xmlRoot(x)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" numAbst <- length(xmlChildren(a))\n", Rd_tag = "RCODE"), │ │ │ │ structure(" absts <- list()\n", Rd_tag = "RCODE"), │ │ │ │ structure(" for (i in 1:numAbst) {\n", Rd_tag = "RCODE"), │ │ │ │ structure(" absts[[i]] <- buildPubMedAbst(a[[i]])\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" }\n", Rd_tag = "RCODE"), structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/buildPubMedAbst.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" }\n", Rd_tag = "RCODE"), structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/buildPubMedAbst.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ chrCats (list) = structure(list(structure(list(structure("Returns a list of chromosome locations from a MAP environment", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("chrCats", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("chrCats", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("createLLChrCats", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("createMAPIncMat", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -845,15 +845,15 @@ │ │ │ │ structure("NA", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(" in the ", Rd_tag = "TEXT"), structure(list( │ │ │ │ structure("MAP", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(" environment, then a list element is not returned\n", Rd_tag = "TEXT"), │ │ │ │ structure(" for that Affy id. \n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("Elizabeth Whalen", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"hgu95av2.db\")\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" mapValues <- chrCats(\"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/chrCats.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" mapValues <- chrCats(\"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/chrCats.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ chromLocation-class (list) = structure(list(structure(list(structure("Class chromLocation, a class for describing genes and their\n", Rd_tag = "TEXT"), │ │ │ │ structure(" chromosome mappings.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("chromLocation-class", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("chromLocation-class", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("chromLocation", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -970,15 +970,15 @@ │ │ │ │ structure(" \n", Rd_tag = "RCODE"), structure(" ## find the number of chromosomes\n", Rd_tag = "RCODE"), │ │ │ │ structure(" nChrom(z)\n", Rd_tag = "RCODE"), structure("\n", Rd_tag = "RCODE"), │ │ │ │ structure(" ## Find the names of the chromosomes\n", Rd_tag = "RCODE"), │ │ │ │ structure(" chromNames(z)\n", Rd_tag = "RCODE"), structure("\n", Rd_tag = "RCODE"), │ │ │ │ structure(" ## get the organism this object refers to\n", Rd_tag = "RCODE"), │ │ │ │ structure(" organism(z)\n", Rd_tag = "RCODE"), structure("\n", Rd_tag = "RCODE"), │ │ │ │ structure(" ## get the lengths of the chromosomes in this object\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" chromLengths(z)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/chromLocation-class.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" chromLengths(z)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/chromLocation-class.Rd", class = "Rd", meta = list( │ │ │ │ docType = "class", generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ compatibleVersions (list) = structure(list(structure(list(structure("function to check to see if the packages represented by the names\n", Rd_tag = "TEXT"), │ │ │ │ structure("passed have the same version number", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("compatibleVersions", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("compatibleVersions", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("misc", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ @@ -995,15 +995,15 @@ │ │ │ │ structure(" TRUE. Otherwise, the function returns FALSE\n", Rd_tag = "TEXT")), Rd_tag = "\\details"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" This function returns TRUE or FALSE depending on whether the packages\n", Rd_tag = "TEXT"), │ │ │ │ structure(" have the same version number\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("Jianhua Zhang", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure(list(structure(list(structure("packageDescription", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"hgu95av2.db\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" library(\"GO.db\")\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" compatibleVersions(\"hgu95av2.db\", \"GO.db\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/compatibleVersions.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" compatibleVersions(\"hgu95av2.db\", \"GO.db\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/compatibleVersions.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ dropECode (list) = structure(list(structure(list(structure("Drop GO labels for specified Evidence Codes", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("dropECode", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("dropECode", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" Genes are mapped to GO terms on the basis of evidence codes. In some\n", Rd_tag = "TEXT"), │ │ │ │ @@ -1035,15 +1035,15 @@ │ │ │ │ structure(list(structure(list(structure(list(structure("getEvidence", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code"), │ │ │ │ structure(", ", Rd_tag = "TEXT"), structure(list(structure(list( │ │ │ │ structure("getOntology", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"hgu95av2.db\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" bb <- hgu95av2GO[[\"39613_at\"]]\n", Rd_tag = "RCODE"), │ │ │ │ structure(" getEvidence(bb[1:3])\n", Rd_tag = "RCODE"), │ │ │ │ structure(" cc <- dropECode(bb[1:3])\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" if (length(cc))\n", Rd_tag = "RCODE"), structure(" getEvidence(cc)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/dropECode.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" if (length(cc))\n", Rd_tag = "RCODE"), structure(" getEvidence(cc)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/dropECode.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ entrezGeneByID (list) = structure(list(structure(list(structure("Create a Query String for an Entrez Gene Identifier", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("entrezGeneByID", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("entrezGeneByID", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("interface", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure("Given a set of UniGene identifiers this function creates a set of URLs\n", Rd_tag = "TEXT"), │ │ │ │ @@ -1062,15 +1062,15 @@ │ │ │ │ structure(list(structure("Marc Carlson", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure("NCBI, ", Rd_tag = "TEXT"), structure(list( │ │ │ │ structure("https://www.ncbi.nih.gov/", Rd_tag = "VERB")), Rd_tag = "\\url"), │ │ │ │ structure(" ", Rd_tag = "TEXT")), Rd_tag = "\\references"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" q1<-entrezGeneByID(c(\"100\", \"1002\"))\n", Rd_tag = "RCODE"), │ │ │ │ structure(" q1\n", Rd_tag = "RCODE"), structure(" if( interactive())\n", Rd_tag = "RCODE"), │ │ │ │ structure(" browseURL(q1[1])\n", Rd_tag = "RCODE"), │ │ │ │ - structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/entrezGeneByID.Rd", class = "Rd", meta = list( │ │ │ │ + structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/entrezGeneByID.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ entrezGeneQuery (list) = structure(list(structure(list(structure("Create a Query String for Entrez Genes", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("entrezGeneQuery", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("entrezGeneQuery", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("interface", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure("Given a set of search terms this function creates a set of URLs\n", Rd_tag = "TEXT"), │ │ │ │ @@ -1089,15 +1089,15 @@ │ │ │ │ structure(list(structure("Marc Carlson", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure("NCBI, ", Rd_tag = "TEXT"), structure(list( │ │ │ │ structure("https://www.ncbi.nih.gov/", Rd_tag = "VERB")), Rd_tag = "\\url"), │ │ │ │ structure(" ", Rd_tag = "TEXT")), Rd_tag = "\\references"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" q1<-entrezGeneQuery(c(\"leukemia\", \"Homo sapiens\"))\n", Rd_tag = "RCODE"), │ │ │ │ structure(" q1\n", Rd_tag = "RCODE"), structure(" if( interactive())\n", Rd_tag = "RCODE"), │ │ │ │ structure(" browseURL(q1[1])\n", Rd_tag = "RCODE"), │ │ │ │ - structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/entrezGeneQuery.Rd", class = "Rd", meta = list( │ │ │ │ + structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/entrezGeneQuery.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ filterGOByOntology (list) = structure(list(structure(list(structure("Filter GO terms by a specified GO ontology", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("filterGOByOntology", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("filterGOByOntology", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" Given a character vector containing GO identifiers, return a logical\n", Rd_tag = "TEXT"), │ │ │ │ @@ -1121,15 +1121,15 @@ │ │ │ │ structure(".\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("Seth Falcon", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure("haveGO <- suppressWarnings(require(\"GO.db\"))\n", Rd_tag = "RCODE"), │ │ │ │ structure("if (haveGO) {\n", Rd_tag = "RCODE"), structure(" ids <- c(\"GO:0001838\", \"GO:0001839\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" stopifnot(all(filterGOByOntology(ids, \"BP\")))\n", Rd_tag = "RCODE"), │ │ │ │ structure(" stopifnot(!any(filterGOByOntology(ids, \"MF\")))\n", Rd_tag = "RCODE"), │ │ │ │ structure("} else cat(\"Sorry, this example requires the GO package\\n\")\n", Rd_tag = "RCODE"), │ │ │ │ - structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/filterGOByOntology.Rd", class = "Rd", meta = list( │ │ │ │ + structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/filterGOByOntology.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ findNeighbors (list) = structure(list(structure(list(structure("A function to locate neighboring genes within a defined range\n", Rd_tag = "TEXT"), │ │ │ │ structure(" around a target gene represented by a Entrez Gene ID ", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("findNeighbors", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("findNeighbors", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("checkArgs", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -1245,15 +1245,15 @@ │ │ │ │ structure(" \"Unconfident\" when a gene can be placed on a chromosome but its exact\n", Rd_tag = "TEXT"), │ │ │ │ structure(" location can not be determined with great confidence.\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("Jianhua Zhang", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure(list(structure("http://www.genome.ucsc.edu/goldenPath/", Rd_tag = "VERB")), Rd_tag = "\\url")), Rd_tag = "\\references"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure("if(require(\"humanCHRLOC\")){\n", Rd_tag = "RCODE"), │ │ │ │ structure(" findNeighbors(\"humanCHRLOC\", \"51806\", 10, upBase = 600000, downBase = 600000)\n", Rd_tag = "RCODE"), │ │ │ │ structure("}else{\n", Rd_tag = "RCODE"), structure(" print(\"Can not find neighbors without the required data package\")\n", Rd_tag = "RCODE"), │ │ │ │ - structure("}\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/findNeighbors.Rd", class = "Rd", meta = list( │ │ │ │ + structure("}\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/findNeighbors.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ genbank (list) = structure(list(structure(list(structure("A function to open the browser to Genbank with the selected gene. ", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("genbank", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("genbank", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("interface ", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" Given a vector of Genbank accession numbers or NCBI UIDs, the user can\n", Rd_tag = "TEXT"), │ │ │ │ @@ -1300,15 +1300,15 @@ │ │ │ │ structure(" disp <- c(\"data\",\"browser\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" } else {\n", Rd_tag = "RCODE"), structure(" disp <- \"data\"\n", Rd_tag = "RCODE"), │ │ │ │ structure(" }\n", Rd_tag = "RCODE"), structure("\n", Rd_tag = "RCODE"), │ │ │ │ structure(" for (dp in disp)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" genbank(\"12345\",\"9997\",disp=dp,type=\"uid\")\n", Rd_tag = "RCODE"), │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure(" ## Use accession numbers to retrieve browser info\n", Rd_tag = "RCODE"), │ │ │ │ structure(" if ( interactive() )\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" genbank(\"U03397\",\"AF030427\",disp=\"browser\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/genbank.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" genbank(\"U03397\",\"AF030427\",disp=\"browser\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/genbank.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ getAnnMap (list) = structure(list(structure(list(structure("Get annotation map", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("getAnnMap", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("getAnnMap", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" This function retrieves a map object from an annotation data\n", Rd_tag = "TEXT"), │ │ │ │ @@ -1383,15 +1383,15 @@ │ │ │ │ structure(list(structure("type", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(" is ", Rd_tag = "TEXT"), structure(list(structure("\"env\"", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(", an R\n", Rd_tag = "TEXT"), structure(" ", Rd_tag = "TEXT"), │ │ │ │ structure(list(structure("environment", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(" object representing the requested map.\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("Seth Falcon", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure("map <- getAnnMap(\"ENTREZID\", \"hgu95av2\", load=TRUE, type=c(\"env\", \"db\"))\n", Rd_tag = "RCODE"), │ │ │ │ - structure("class(map)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/getAnnMap.Rd", class = "Rd", meta = list( │ │ │ │ + structure("class(map)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getAnnMap.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ getEvidence (list) = structure(list(structure(list(structure("Get the Evidence codes for a set of GO terms.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("getEvidence", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("getEvidence", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" For each mapping of a gene to a GO term there are a set of evidence\n", Rd_tag = "TEXT"), │ │ │ │ @@ -1409,15 +1409,15 @@ │ │ │ │ structure(" vector of evidence codes.\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("R. Gentleman", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure(list(structure(list(structure("getOntology", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code"), │ │ │ │ structure(", ", Rd_tag = "TEXT"), structure(list(structure(list( │ │ │ │ structure("dropECode", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"hgu95av2.db\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" bb <- hgu95av2GO[[\"39613_at\"]]\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" getEvidence(bb)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/getEvidence.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" getEvidence(bb)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getEvidence.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ getGOTerm (list) = structure(list(structure(list(structure("Functions to Access GO data.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("getGOTerm", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("getGOTerm", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("getGOParents", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("getGOChildren", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -1467,15 +1467,15 @@ │ │ │ │ structure(list(structure("The Gene Ontology Consortium", Rd_tag = "TEXT")), Rd_tag = "\\references"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"GO.db\")\n", Rd_tag = "RCODE"), │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure(" sG <- sample(keys(GO.db, \"GOID\"), 8)\n", Rd_tag = "RCODE"), │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure(" gT <- getGOTerm(sG)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" gP <- getGOParents(sG)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" gC <- getGOChildren(sG)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" gcat <- getGOOntology(sG)\n", Rd_tag = "RCODE"), │ │ │ │ - structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/getGOTerm.Rd", class = "Rd", meta = list( │ │ │ │ + structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getGOTerm.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ getOntology (list) = structure(list(structure(list(structure("Get GO terms for a specified ontology", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("getOntology", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("getOntology", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure("Find the subset of GO terms for the specified ontology, for each element \n", Rd_tag = "TEXT"), │ │ │ │ @@ -1505,15 +1505,15 @@ │ │ │ │ structure(" the requested ontology.\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("R. Gentleman", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure(list(structure(list(structure("getEvidence", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code"), │ │ │ │ structure(", ", Rd_tag = "TEXT"), structure(list(structure(list( │ │ │ │ structure("dropECode", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"hgu95av2.db\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" bb <- hgu95av2GO[[\"39613_at\"]]\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" getOntology(bb)\n", Rd_tag = "RCODE"), structure(" sapply(bb, function(x) x$Ontology)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/getOntology.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" getOntology(bb)\n", Rd_tag = "RCODE"), structure(" sapply(bb, function(x) x$Ontology)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getOntology.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ getPMInfo (list) = structure(list(structure(list(structure("extract publication details and abstract from annotate::pubmed function output ", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("getPMInfo", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("getPMInfo", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure(" models ", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure("extract publication details and abstract from annotate::pubmed function output \n", Rd_tag = "TEXT")), Rd_tag = "\\description"), │ │ │ │ @@ -1528,15 +1528,15 @@ │ │ │ │ structure("the list is in turn a list with elements for author list, title, journal\n", Rd_tag = "TEXT"), │ │ │ │ structure("info, and abstract text.\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("this should be turned into a method returning an instance of\n", Rd_tag = "TEXT"), │ │ │ │ structure("a formal class representing articles. ", Rd_tag = "TEXT")), Rd_tag = "\\note"), │ │ │ │ structure(list(structure("Vince Carey ", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure("demo <- pubmed(\"11780146\", \n", Rd_tag = "RCODE"), │ │ │ │ structure(" \"11886385\", \"11884611\")\n", Rd_tag = "RCODE"), │ │ │ │ - structure("getPMInfo(demo)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/getPMInfo.Rd", class = "Rd", meta = list( │ │ │ │ + structure("getPMInfo(demo)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getPMInfo.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ getSYMBOL (list) = structure(list(structure(list(structure("Functions to deal with Data Packages", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("getSYMBOL", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("getSYMBOL", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("getGO", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("getGOdesc", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -1624,15 +1624,15 @@ │ │ │ │ structure(" gg <- getGO(gN, \"hgu95av2\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" lookUp(gg[[2]][[1]][[\"GOID\"]], \"GO\", \"TERM\")\n", Rd_tag = "RCODE"), │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure(" # Same as lookUp for TERM\n", Rd_tag = "RCODE"), │ │ │ │ structure(" getGOdesc(gg[[2]][[1]][[\"GOID\"]], \"ANY\")\n", Rd_tag = "RCODE"), │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure(" # For BP only\n", Rd_tag = "RCODE"), │ │ │ │ structure(" getGOdesc(gg[[2]][[1]][[\"GOID\"]], \"BP\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" getEG(gN, \"hgu95av2\")\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" getPMID(gN, \"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/getSYMBOL.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" getPMID(gN, \"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getSYMBOL.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ getSeq4Acc (list) = structure(list(structure(list(structure("Queries the NCBI database to obtain the sequence for a given\n", Rd_tag = "TEXT"), │ │ │ │ structure(" GenBank Accession number", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("getSEQ", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("getGI", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("getSEQ", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -1659,15 +1659,15 @@ │ │ │ │ structure(" identification line of the sequence data is then dropped to return only\n", Rd_tag = "TEXT"), │ │ │ │ structure(" the nucleotide sequence. \n", Rd_tag = "TEXT"), │ │ │ │ structure("\n", Rd_tag = "TEXT"), structure(" getGI returns the gi number corresponding to a given GenBank accession\n", Rd_tag = "TEXT"), │ │ │ │ structure(" number.\n", Rd_tag = "TEXT")), Rd_tag = "\\details"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" getSEQ returns a character string of nucleotide sequence\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("Jianhua Zhang", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure(list(structure("https://www.ncbi.nlm.nih.gov/entrez/query.fcgi", Rd_tag = "VERB")), Rd_tag = "\\url")), Rd_tag = "\\references"), │ │ │ │ - structure(list(structure("\n", Rd_tag = "RCODE"), structure("getSEQ(\"M22490\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/getSeq4Acc.Rd", class = "Rd", meta = list( │ │ │ │ + structure(list(structure("\n", Rd_tag = "RCODE"), structure("getSEQ(\"M22490\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getSeq4Acc.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ getTDRows (list) = structure(list(structure(list(structure("Functions to create hypertext links that can be placed in a table\n", Rd_tag = "TEXT"), │ │ │ │ structure(" cell of a HTML file ", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("getQueryLink", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("getQueryLink", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("getQuery4UG", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -1783,15 +1783,15 @@ │ │ │ │ structure("\n", Rd_tag = "TEXT"), structure(" Also note that creating additional links is quite simple. First, define\n", Rd_tag = "TEXT"), │ │ │ │ structure(" a new 'getQuery4XX()' function modeled on the existing functions, then\n", Rd_tag = "TEXT"), │ │ │ │ structure(" add this function to the ", Rd_tag = "TEXT"), │ │ │ │ structure(list(structure("getQueryLink", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(" function.\n", Rd_tag = "TEXT"), structure(" \n", Rd_tag = "TEXT")), Rd_tag = "\\details"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" Returns a vector of character strings representing the hypertext links.\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure(" Jianhua Zhang with further\n", Rd_tag = "TEXT"), │ │ │ │ - structure(" modifications by James W. MacDonald ", Rd_tag = "TEXT")), Rd_tag = "\\author")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/getTDRows.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" modifications by James W. MacDonald ", Rd_tag = "TEXT")), Rd_tag = "\\author")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getTDRows.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ hasGOannote (list) = structure(list(structure(list(structure("Check for GO annotation", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("hasGOannote", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("hasGOannote", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" Given a GO term, or a vector of GO terms and an ontology this function\n", Rd_tag = "TEXT"), │ │ │ │ @@ -1815,15 +1815,15 @@ │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" A logical vector of the same length as ", Rd_tag = "TEXT"), │ │ │ │ structure(list(structure("x", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(".\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("R. Gentleman", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure(list(structure(list(structure("get", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"GO.db\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" t1 <- \"GO:0003680\"\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" hasGOannote(t1)\n", Rd_tag = "RCODE"), structure(" hasGOannote(t1, \"BP\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/hasGOannote.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" hasGOannote(t1)\n", Rd_tag = "RCODE"), structure(" hasGOannote(t1, \"BP\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hasGOannote.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ hgByChroms (list) = structure(list(structure(list(structure(" A dataset to show the human genome base pair locations per\n", Rd_tag = "TEXT"), │ │ │ │ structure(" chromosome. ", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("hgByChroms", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("hgByChroms", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("datasets", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ @@ -1831,28 +1831,28 @@ │ │ │ │ structure(list(structure("data(hgByChroms)", Rd_tag = "RCODE")), Rd_tag = "\\usage"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" A list, with the names consisting of the names of the chromosomes in\n", Rd_tag = "TEXT"), │ │ │ │ structure(" the human genome (thus 24 elements). Each element consists of a named\n", Rd_tag = "TEXT"), │ │ │ │ structure(" vector of +/- values - where each value represents the location of a\n", Rd_tag = "TEXT"), │ │ │ │ structure(" base pair (the numeric value is the location, while the +/- denotes\n", Rd_tag = "TEXT"), │ │ │ │ structure(" the strand value), with the name providing the name of the base pair.\n", Rd_tag = "TEXT")), Rd_tag = "\\format"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" Cheng Li of the Dana-Farber Cancer Institute.\n", Rd_tag = "TEXT")), Rd_tag = "\\source"), │ │ │ │ - structure(list(structure("\n", Rd_tag = "RCODE"), structure(" data(hgByChroms)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/hgByChroms.Rd", class = "Rd", meta = list( │ │ │ │ + structure(list(structure("\n", Rd_tag = "RCODE"), structure(" data(hgByChroms)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hgByChroms.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ hgCLengths (list) = structure(list(structure(list(structure(" A dataset which contains the lengths (in base pairs) of the\n", Rd_tag = "TEXT"), │ │ │ │ structure(" human chromosomes. ", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("hgCLengths", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("hgCLengths", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("datasets", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" The data is described above.\n", Rd_tag = "TEXT")), Rd_tag = "\\description"), │ │ │ │ structure(list(structure("data(hgCLengths)", Rd_tag = "RCODE")), Rd_tag = "\\usage"), │ │ │ │ structure(list(structure("A vector containing 24 values, each corresponding to the total\n", Rd_tag = "TEXT"), │ │ │ │ structure("chromosome length. ", Rd_tag = "TEXT")), Rd_tag = "\\format"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" UCSC Human Genome Project\n", Rd_tag = "TEXT")), Rd_tag = "\\source"), │ │ │ │ - structure(list(structure("\n", Rd_tag = "RCODE"), structure(" data(hgCLengths)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/hgCLengths.Rd", class = "Rd", meta = list( │ │ │ │ + structure(list(structure("\n", Rd_tag = "RCODE"), structure(" data(hgCLengths)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hgCLengths.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ hgu95AProbLocs (list) = structure(list(structure(list(structure("chromLocation instance hgu95AProbLocs, an example of a chromLocation \n", Rd_tag = "TEXT"), │ │ │ │ structure("object", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("hgu95AProbLocs", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("hgu95AProbLocs", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("methods", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ @@ -1882,15 +1882,15 @@ │ │ │ │ structure("\n", Rd_tag = "TEXT"), structure(" ", Rd_tag = "TEXT"), │ │ │ │ structure(list(list(structure(list(structure("geneToChrom", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(":", Rd_tag = "TEXT")), list(structure("Object of class environment", Rd_tag = "TEXT"))), Rd_tag = "\\item"), │ │ │ │ structure("\n", Rd_tag = "TEXT"), structure(" ", Rd_tag = "TEXT"), │ │ │ │ structure(list(list(structure(list(structure("class", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(":", Rd_tag = "TEXT")), list(structure("Object of class character, value: 'chromLocation'", Rd_tag = "TEXT"))), Rd_tag = "\\item"), │ │ │ │ structure("\n", Rd_tag = "TEXT"), structure(" ", Rd_tag = "TEXT")), Rd_tag = "\\describe"), │ │ │ │ - structure("\n", Rd_tag = "TEXT"))), Rd_tag = "\\section")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/hgu95AProbLocs.Rd", class = "Rd", meta = list( │ │ │ │ + structure("\n", Rd_tag = "TEXT"))), Rd_tag = "\\section")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hgu95AProbLocs.Rd", class = "Rd", meta = list( │ │ │ │ docType = "methods", generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ hgu95Achroloc (list) = structure(list(structure(list(structure("Annotation data for the Affymetrix HGU95A GeneChip", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("hgu95Achroloc", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("hgu95Achroloc", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("datasets", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("Data, in the form of environments for the Affymetrix U95A\n", Rd_tag = "TEXT"), │ │ │ │ @@ -1908,15 +1908,15 @@ │ │ │ │ structure(list(structure("The ", Rd_tag = "TEXT"), structure(list( │ │ │ │ structure("AnnBuilder", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(" package.", Rd_tag = "TEXT")), Rd_tag = "\\source"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" data(hgu95Achroloc)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" data(sample.ExpressionSet)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" mget(featureNames(sample.ExpressionSet)[330:340], env=hgu95Achroloc, \n", Rd_tag = "RCODE"), │ │ │ │ structure(" ifnotfound=NA)\n", Rd_tag = "RCODE"), │ │ │ │ - structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/hgu95Achroloc.Rd", class = "Rd", meta = list( │ │ │ │ + structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hgu95Achroloc.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ hgu95Achrom (list) = structure(list(structure(list(structure("Annotation data for the Affymetrix HGU95A GeneChip", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("hgu95Achrom", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("hgu95Achrom", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("datasets", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("Data, in the form of environments for the Affymetrix U95A\n", Rd_tag = "TEXT"), │ │ │ │ @@ -1932,15 +1932,15 @@ │ │ │ │ structure(" then the current \n", Rd_tag = "TEXT"), structure(" mapping was unable to identify this. Mappings and data sources are\n", Rd_tag = "TEXT"), │ │ │ │ structure(" constantly evolving so updating often is recommended.\n", Rd_tag = "TEXT")), Rd_tag = "\\format"), │ │ │ │ structure(list(structure("The ", Rd_tag = "TEXT"), structure(list( │ │ │ │ structure("AnnBuilder", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(" package.", Rd_tag = "TEXT")), Rd_tag = "\\source"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" data(hgu95Achrom)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" data(sample.ExpressionSet)\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" mget(featureNames(sample.ExpressionSet)[330:340], env=hgu95Achrom, ifnotfound=NA)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/hgu95Achrom.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" mget(featureNames(sample.ExpressionSet)[330:340], env=hgu95Achrom, ifnotfound=NA)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hgu95Achrom.Rd", class = "Rd", meta = list( │ │ │ │ docType = "data", generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ hgu95All (list) = structure(list(structure(list(structure("Annotation data for the Affymetrix HGU95A GeneChip", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("hgu95All", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("hgu95All", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("datasets", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("Data, in the form of environments for the Affymetrix U95A\n", Rd_tag = "TEXT"), │ │ │ │ @@ -1956,15 +1956,15 @@ │ │ │ │ structure(" constantly evolving so updating often is recommended.\n", Rd_tag = "TEXT")), Rd_tag = "\\format"), │ │ │ │ structure(list(structure("The ", Rd_tag = "TEXT"), structure(list( │ │ │ │ structure("AnnBuilder", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(" package.", Rd_tag = "TEXT")), Rd_tag = "\\source"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" data(hgu95All)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" data(sample.ExpressionSet)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" mget(featureNames(sample.ExpressionSet)[330:340], env=hgu95All, ifnotfound=NA)\n", Rd_tag = "RCODE"), │ │ │ │ - structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/hgu95All.Rd", class = "Rd", meta = list( │ │ │ │ + structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hgu95All.Rd", class = "Rd", meta = list( │ │ │ │ docType = "data", generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ hgu95Asym (list) = structure(list(structure(list(structure("Annotation data for the Affymetrix HGU95A GeneChip", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("hgu95Asym", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("hgu95Asym", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("datasets", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("Data, in the form of environments for the Affymetrix U95A\n", Rd_tag = "TEXT"), │ │ │ │ @@ -1979,15 +1979,15 @@ │ │ │ │ structure(" then the current \n", Rd_tag = "TEXT"), structure(" mapping was unable to identify this. Mappings and data sources are\n", Rd_tag = "TEXT"), │ │ │ │ structure(" constantly evolving so updating often is recommended.\n", Rd_tag = "TEXT")), Rd_tag = "\\format"), │ │ │ │ structure(list(structure("The ", Rd_tag = "TEXT"), structure(list( │ │ │ │ structure("AnnBuilder", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(" package.", Rd_tag = "TEXT")), Rd_tag = "\\source"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" data(hgu95Asym)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" data(sample.ExpressionSet)\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" mget(featureNames(sample.ExpressionSet)[330:340], env=hgu95Asym, ifnotfound=NA)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/hgu95Asym.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" mget(featureNames(sample.ExpressionSet)[330:340], env=hgu95Asym, ifnotfound=NA)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hgu95Asym.Rd", class = "Rd", meta = list( │ │ │ │ docType = "data", generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ hideOutput (NULL) = NULL │ │ │ │ │ │ │ │ homoData-class (list) = structure(list(structure(list(structure("Class \"homoData\"", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("homoData-class", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("homoData-class", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -2106,15 +2106,15 @@ │ │ │ │ structure(" function for slot ", Rd_tag = "TEXT"), │ │ │ │ structure(list(structure("homoHGID", Rd_tag = "RCODE")), Rd_tag = "\\code"))), Rd_tag = "\\item"), │ │ │ │ structure("\n", Rd_tag = "TEXT"), structure(" ", Rd_tag = "TEXT")), Rd_tag = "\\describe"), │ │ │ │ structure("\n", Rd_tag = "TEXT"))), Rd_tag = "\\section"), │ │ │ │ structure(list(structure("Jianhua Zhang", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure(list(structure("ftp://ftp.ncbi.nih.gov/pub/HomoloGene/README", Rd_tag = "VERB")), Rd_tag = "\\url")), Rd_tag = "\\references"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" new(\"homoData\", homoPS = 82.3, homoLL = 2324853, homoOrg = \"Homo sapins\",\n", Rd_tag = "RCODE"), │ │ │ │ - structure("homoType = \"B\", homoURL = \"\", homoHGID = 12345)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/homoData-class.Rd", class = "Rd", meta = list( │ │ │ │ + structure("homoType = \"B\", homoURL = \"\", homoHGID = 12345)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/homoData-class.Rd", class = "Rd", meta = list( │ │ │ │ docType = "class", generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ htmlpage (list) = structure(list(structure(list(structure("Functions to build HTML pages", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("htmlpage", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("htmlpage", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure(" This function is designed to create an HTML table\n", Rd_tag = "TEXT"), │ │ │ │ @@ -2229,15 +2229,15 @@ │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure(" otherdata <- list(symb, desc, t.stat, p.value, fold.change, expression)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" table.head <- c(\"UniGene\", \"RefSeq\", \"EntrezGene\", \"Symbol\",\n", Rd_tag = "RCODE"), │ │ │ │ structure(" \"Description\", \"t-stat\", \"p-value\", \"fold change\",\n", Rd_tag = "RCODE"), │ │ │ │ structure(" paste(\"Sample\", 1:4))\n", Rd_tag = "RCODE"), │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure(" htmlpage(genelist, \"test.html\", \"Some gene expression data\", otherdata,\n", Rd_tag = "RCODE"), │ │ │ │ structure(" table.head, repository = list(\"ug\",\"gb\",\"en\"))\n", Rd_tag = "RCODE"), │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure(" if(!interactive())\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" file.remove(\"test.html\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/htmlpage.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" file.remove(\"test.html\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/htmlpage.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ isValidkey (list) = structure(list(structure(list(structure("Get or verify valid IDs for a package or OrgDb object.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("isValidKey", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("isValidKey", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("allValidKeys", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("isValidKey,character,character-method", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -2288,15 +2288,15 @@ │ │ │ │ structure(" ids <- c(\"15S_rRNA_2\",\"21S_rRNA_4\",\"15S_rRNA\")\n", Rd_tag = "VERB"), │ │ │ │ structure(" isValidKey(ids, \"org.Sc.sgd\")\n", Rd_tag = "VERB"), │ │ │ │ structure("\n", Rd_tag = "VERB"), structure(" ## 2 good IDs and a 3rd that will not be valid\n", Rd_tag = "VERB"), │ │ │ │ structure(" ids <- c(\"5600\",\"7531\", \"altSymbol\")\n", Rd_tag = "VERB"), │ │ │ │ structure(" isValidKey(ids, \"org.Hs.eg\")\n", Rd_tag = "VERB"), │ │ │ │ structure("\n", Rd_tag = "VERB"), structure(" ## Get all the valid primary id from org.Hs.eg.db\n", Rd_tag = "VERB"), │ │ │ │ structure(" allValidKeys(\"org.Hs.eg\")\n", Rd_tag = "VERB")), Rd_tag = "\\dontrun"), │ │ │ │ - structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/isValidkey.Rd", class = "Rd", meta = list( │ │ │ │ + structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/isValidkey.Rd", class = "Rd", meta = list( │ │ │ │ docType = "methods", generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ makeAnchor (list) = structure(list(structure(list(structure("A Function To Generate HTML Anchors", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("makeAnchor", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("makeAnchor", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("utilities", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" This function will take a set of links and titles and will generate\n", Rd_tag = "TEXT"), │ │ │ │ @@ -2310,15 +2310,15 @@ │ │ │ │ list(structure("A vector of website names", Rd_tag = "TEXT"))), Rd_tag = "\\item"), │ │ │ │ structure("\n", Rd_tag = "TEXT"), structure(" ", Rd_tag = "TEXT"), │ │ │ │ structure(list(list(structure("toMain", Rd_tag = "TEXT")), │ │ │ │ list(structure("Used for frame pages", Rd_tag = "TEXT"))), Rd_tag = "\\item"), │ │ │ │ structure("\n", Rd_tag = "TEXT")), Rd_tag = "\\arguments"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" A vector of HTML anchor tags\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("Jeff Gentry", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ - structure(list(structure("\n", Rd_tag = "RCODE"), structure("makeAnchor(\"http://www.bioconductor.org\",\"Bioconductor\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/makeAnchor.Rd", class = "Rd", meta = list( │ │ │ │ + structure(list(structure("\n", Rd_tag = "RCODE"), structure("makeAnchor(\"http://www.bioconductor.org\",\"Bioconductor\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/makeAnchor.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ mapOrgs (list) = structure(list(structure(list(structure("Functions to map to organism IDs used by NCBI homology.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("mapOrgs", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("mapOrgs", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("getOrgNameNCode", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ @@ -2334,15 +2334,15 @@ │ │ │ │ list(structure(list(structure("what", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(" a character string that can either be \"code\"\n", Rd_tag = "TEXT"), │ │ │ │ structure(" or \"name\".", Rd_tag = "TEXT"))), Rd_tag = "\\item"), │ │ │ │ structure("\n", Rd_tag = "TEXT")), Rd_tag = "\\arguments"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" mapOrgs converts organism codes to scientific names.\n", Rd_tag = "TEXT")), Rd_tag = "\\details"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" mapOrgs returns a vector of character strings.\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("Jianhua Zhang", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ - structure(list(structure(list(structure("ftp://ftp.ncbi.nih.gov/pub/HomoloGene/README", Rd_tag = "VERB")), Rd_tag = "\\url")), Rd_tag = "\\references")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/mapOrgs.Rd", class = "Rd", meta = list( │ │ │ │ + structure(list(structure(list(structure("ftp://ftp.ncbi.nih.gov/pub/HomoloGene/README", Rd_tag = "VERB")), Rd_tag = "\\url")), Rd_tag = "\\references")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/mapOrgs.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ organism (list) = structure(list(structure(list(structure("Convenience function for getting the organism from an object or package", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("organism", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("organism", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("organism,character-method", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ @@ -2358,15 +2358,15 @@ │ │ │ │ structure(list(structure("Marc Carlson", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" require(hgu95av2.db)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" ## get the organism for this annotation package\n", Rd_tag = "RCODE"), │ │ │ │ structure(" organism(\"hgu95av2\")\n", Rd_tag = "RCODE"), │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure(" ## get the organism this object refers to\n", Rd_tag = "RCODE"), │ │ │ │ structure(" ## (for a ChromLocation object)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" z <- buildChromLocation(\"hgu95av2\")\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" organism(z)\n", Rd_tag = "RCODE"), structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/organism.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" organism(z)\n", Rd_tag = "RCODE"), structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/organism.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ pm.abstGrep (list) = structure(list(structure(list(structure("An interface to grep for PubMed abstracts.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("pm.abstGrep", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("pm.abstGrep", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" A user friendly interface to the functionality provided by\n", Rd_tag = "TEXT"), │ │ │ │ @@ -2401,15 +2401,15 @@ │ │ │ │ structure(list(structure(list(structure(list(structure("pm.getabst", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code"), │ │ │ │ structure(", ", Rd_tag = "TEXT"), structure(list(structure(list( │ │ │ │ structure("pm.titles", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"hgu95av2.db\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" hoxa9 <- \"37806_at\"\n", Rd_tag = "RCODE"), │ │ │ │ structure(" absts <- pm.getabst(hoxa9, \"hgu95av2\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" pm.abstGrep(\"SH3\", absts[[1]])\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" pm.abstGrep(\"autism\", absts[[1]])\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/pm.abstGrep.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" pm.abstGrep(\"autism\", absts[[1]])\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pm.abstGrep.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ pm.getabst (list) = structure(list(structure(list(structure("Obtain the abstracts for a set PubMed list.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("pm.getabst", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("pm.getabst", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure("The data provided by PubMed is reduced to a small set. This set is \n", Rd_tag = "TEXT"), │ │ │ │ @@ -2446,15 +2446,15 @@ │ │ │ │ structure(" the gene identifier.\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("Robert Gentleman", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure(list(structure(list(structure("pm.abstGrep", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code"), │ │ │ │ structure(", ", Rd_tag = "TEXT"), structure(list(structure(list( │ │ │ │ structure("pm.titles", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"hgu95av2.db\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" hoxa9 <- \"37806_at\"\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" absts <- pm.getabst(hoxa9, \"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/pm.getabst.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" absts <- pm.getabst(hoxa9, \"hgu95av2\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pm.getabst.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ pm.titles (list) = structure(list(structure(list(structure("Obtain the titles of the PubMed abstracts.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("pm.titles", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("pm.titles", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" This function returns the titles from a list of PubMed abstracts.\n", Rd_tag = "TEXT")), Rd_tag = "\\description"), │ │ │ │ @@ -2469,15 +2469,15 @@ │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure("A character vector of length equal to the number of abstracts. Each\n", Rd_tag = "TEXT"), │ │ │ │ structure("element is the title of the corresponding abstract.\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("Robert Gentleman", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure(list(structure(list(structure("pm.abstGrep", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" library(\"hgu95av2.db\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" hoxa9 <- \"37806_at\"\n", Rd_tag = "RCODE"), │ │ │ │ structure(" absts <- pm.getabst(hoxa9, \"hgu95av2\")\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" pm.titles(absts)[[1]][[1]]\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/pm.titles.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" pm.titles(absts)[[1]][[1]]\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pm.titles.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ pmAbst2HTML (list) = structure(list(structure(list(structure("HTML Generation for PubMed Abstracts", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("pmAbst2HTML", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("pmAbst2HTML", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("utilities", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" This function will take a ", Rd_tag = "TEXT"), │ │ │ │ @@ -2568,15 +2568,15 @@ │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure(" if (interactive())\n", Rd_tag = "RCODE"), │ │ │ │ structure(" browseURL(paste(\"file://\",fname,sep=\"\"))\n", Rd_tag = "RCODE"), │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure(" ## Now try it w/ frames, using temporary files again.\n", Rd_tag = "RCODE"), │ │ │ │ structure(" fnameBase <- tempfile()\n", Rd_tag = "RCODE"), │ │ │ │ structure(" pmAbst2HTML(absts,filename=fnameBase, frames=TRUE)\n", Rd_tag = "RCODE"), │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure(" if (interactive())\n", Rd_tag = "RCODE"), │ │ │ │ structure(" browseURL(paste(\"file://\",fnameBase,\"index.html\",sep=\"\"))\n", Rd_tag = "RCODE"), │ │ │ │ - structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/pmAbst2HTML.Rd", class = "Rd", meta = list( │ │ │ │ + structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pmAbst2HTML.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ pmid2MIAME (list) = structure(list(structure(list(structure("use web to populate MIAME instance with pubmed details ", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("pmid2MIAME", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("pmid2MIAME", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure(" models ", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("use web to populate MIAME instance with pubmed details\n", Rd_tag = "TEXT")), Rd_tag = "\\description"), │ │ │ │ @@ -2587,15 +2587,15 @@ │ │ │ │ structure("\n", Rd_tag = "TEXT")), Rd_tag = "\\arguments"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure("uses XML library to decode parts of the query response and\n", Rd_tag = "TEXT"), │ │ │ │ structure("load a MIAME object\n", Rd_tag = "TEXT")), Rd_tag = "\\details"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure("An instance of class ", Rd_tag = "TEXT"), │ │ │ │ structure(list(structure(list(structure("MIAME", Rd_tag = "TEXT")), Rd_tag = "\\link", Rd_option = structure("Biobase:MIAME-class", Rd_tag = "TEXT"))), Rd_tag = "\\code"), │ │ │ │ structure("\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("Vince Carey ", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ - structure(list(structure("\n", Rd_tag = "RCODE"), structure("if (interactive()) pmid2MIAME(\"9843569\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/pmid2MIAME.Rd", class = "Rd", meta = list( │ │ │ │ + structure(list(structure("\n", Rd_tag = "RCODE"), structure("if (interactive()) pmid2MIAME(\"9843569\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pmid2MIAME.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ pmidQuery (list) = structure(list(structure(list(structure("A function to query PubMed", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("pmidQuery", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("pmidQuery", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("interface", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" Given a PMID, will create a URL which can be used to open a\n", Rd_tag = "TEXT"), │ │ │ │ @@ -2610,15 +2610,15 @@ │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" A character string containing the appropriate URL\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure("Jeff Gentry", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure("NCBI, ", Rd_tag = "TEXT"), structure(list( │ │ │ │ structure("https://www.ncbi.nih.gov/", Rd_tag = "VERB")), Rd_tag = "\\url"), │ │ │ │ structure(" ", Rd_tag = "TEXT")), Rd_tag = "\\references"), │ │ │ │ structure(list(structure(list(structure(list(structure("UniGeneQuery", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" a <- \"9695952\"\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" pmidQuery(a)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/pmidQuery.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" pmidQuery(a)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pmidQuery.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ pubMedAbst-class (list) = structure(list(structure(list(structure("Class pubMedAbst, a class to handle PubMed abstracts, and methods\n", Rd_tag = "TEXT"), │ │ │ │ structure("for processing them.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("pubMedAbst-class", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("pubMedAbst-class", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("pubMedAbst", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -2751,15 +2751,15 @@ │ │ │ │ structure("genbank", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" x <- pubmed(\"9695952\",\"8325638\",\"8422497\")\n", Rd_tag = "RCODE"), │ │ │ │ structure(" a <- xmlRoot(x)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" numAbst <- length(xmlChildren(a))\n", Rd_tag = "RCODE"), │ │ │ │ structure(" absts <- list()\n", Rd_tag = "RCODE"), │ │ │ │ structure(" for (i in 1:numAbst) {\n", Rd_tag = "RCODE"), │ │ │ │ structure(" absts[[i]] <- buildPubMedAbst(a[[i]])\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" }\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/pubMedAbst-class.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" }\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pubMedAbst-class.Rd", class = "Rd", meta = list( │ │ │ │ docType = "class", generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ pubmed (list) = structure(list(structure(list(structure("A function to open the browser to Pubmed with the selected gene. ", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("pubmed", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("pubmed", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure(" interface ", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" Given a vector of Pubmed identifiers or accession numbers, the user\n", Rd_tag = "TEXT"), │ │ │ │ @@ -2801,15 +2801,15 @@ │ │ │ │ structure(list(structure(list(structure(list(structure("genbank", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code"), │ │ │ │ structure(", ", Rd_tag = "TEXT"), structure(list(structure(list( │ │ │ │ structure("xmlTreeParse", Rd_tag = "TEXT")), Rd_tag = "\\link", Rd_option = structure("XML", Rd_tag = "TEXT"))), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" if( interactive() )\n", Rd_tag = "RCODE"), │ │ │ │ structure(" opts <- c(\"data\",\"browser\") else\n", Rd_tag = "RCODE"), │ │ │ │ structure(" opts <- \"data\"\n", Rd_tag = "RCODE"), │ │ │ │ structure(" for (dp in opts)\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" pubmed(\"11780146\",\"11886385\",\"11884611\",disp=dp)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/pubmed.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" pubmed(\"11780146\",\"11886385\",\"11884611\",disp=dp)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pubmed.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ readGEOAnn (list) = structure(list(structure(list(structure("Function to extract data from the GEO web site", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("readGEOAnn", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("readGEOAnn", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("readIDNAcc", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("getGPLNames", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -2881,15 +2881,15 @@ │ │ │ │ structure(list(structure("Jianhua Zhang", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure(list(structure("www.ncbi.nlm.nih.gov/geo", Rd_tag = "VERB")), Rd_tag = "\\url")), Rd_tag = "\\references"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure("# Get array names and GEO accession numbers\n", Rd_tag = "RCODE"), │ │ │ │ structure("#geoAccNums <- getGPLNames()\n", Rd_tag = "RCODE"), │ │ │ │ structure("# Read the annotation data file for HG-U133A which is GPL96 based on\n", Rd_tag = "RCODE"), │ │ │ │ structure("# examining geoAccNums \n", Rd_tag = "RCODE"), │ │ │ │ structure("#temp <- readGEOAnn(GEOAccNum = \"GPL96\")\n", Rd_tag = "RCODE"), │ │ │ │ - structure("#temp2 <- readIDNAcc(GEOAccNum = \"GPL96\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/readGEOAnn.Rd", class = "Rd", meta = list( │ │ │ │ + structure("#temp2 <- readIDNAcc(GEOAccNum = \"GPL96\")\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/readGEOAnn.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ safeDeparse (closure) = function (obj) │ │ │ │ { │ │ │ │ tryCatch({ │ │ │ │ deparse(obj) │ │ │ │ }, error = function(e) { │ │ │ │ @@ -2956,15 +2956,15 @@ │ │ │ │ structure(list(structure(list(structure(list(structure("gzfile", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code"), │ │ │ │ structure(",\n", Rd_tag = "TEXT"), structure(" ", Rd_tag = "TEXT"), │ │ │ │ structure(list(structure(list(structure("serialize", Rd_tag = "TEXT")), Rd_tag = "\\link")), Rd_tag = "\\code")), Rd_tag = "\\seealso"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" z <- new.env()\n", Rd_tag = "RCODE"), │ │ │ │ structure(" assign(\"a\", 1, env=z)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" assign(\"b\", 2, env=z)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" assign(\"c\", 3, env=z)\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" serializeEnv(z, tempfile())\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/serializeEnv.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" serializeEnv(z, tempfile())\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/serializeEnv.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ setRepository (list) = structure(list(structure(list(structure("Functions to add arbitrary repositories", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("setRepository", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("setRepository", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("getRepositories", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("clearRepository", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ @@ -3034,15 +3034,15 @@ │ │ │ │ structure(" species <- list(...)$species\n", Rd_tag = "RCODE"), │ │ │ │ structure(" else\n", Rd_tag = "RCODE"), structure(" stop(\"To make links for Ensembl, you need to pass a 'species' argument.\",\n", Rd_tag = "RCODE"), │ │ │ │ structure(" call. = FALSE)\n", Rd_tag = "RCODE"), │ │ │ │ structure("out <- paste(\"http://www.ensembl.org/\", species, \"/Search/Summary?species=\",\n", Rd_tag = "RCODE"), │ │ │ │ structure(" species, \";idx=;q=\", ids, sep = \"\")\n", Rd_tag = "RCODE"), │ │ │ │ structure("out\n", Rd_tag = "RCODE"), structure("}\n", Rd_tag = "RCODE"), │ │ │ │ structure("\n", Rd_tag = "RCODE"), structure("setRepository(\"species_arg\", repofun)\n", Rd_tag = "RCODE"), │ │ │ │ - structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/setRepository.Rd", class = "Rd", meta = list( │ │ │ │ + structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/setRepository.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ updateSymbolsToValidKeys (list) = structure(list(structure(list(structure("Take a list of symbols and translate them into the best possible\n", Rd_tag = "TEXT"), │ │ │ │ structure(" ID for a package.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("updateSymbolsToValidKeys", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("updateSymbolsToValidKeys", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("manip", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ @@ -3070,15 +3070,15 @@ │ │ │ │ structure("\n", Rd_tag = "VERB"), structure(" ## one \"bad\" ID, one that can be mapped onto a valid ID, and a 3rd\n", Rd_tag = "VERB"), │ │ │ │ structure(" ## which already is a valid ID\n", Rd_tag = "VERB"), │ │ │ │ structure(" syms <- c(\"15S_rRNA_2\",\"21S_rRNA_4\",\"15S_rRNA\")\n", Rd_tag = "VERB"), │ │ │ │ structure(" updateSymbolsToValidKeys(syms, \"org.Sc.sgd\")\n", Rd_tag = "VERB"), │ │ │ │ structure("\n", Rd_tag = "VERB"), structure(" ## 3 symbols and a 4th that will NOT be valid\n", Rd_tag = "VERB"), │ │ │ │ structure(" syms <- c(\"MAPK11\",\"P38B\",\"FLJ45465\", \"altSymbol\")\n", Rd_tag = "VERB"), │ │ │ │ structure(" updateSymbolsToValidKeys(syms, \"org.Hs.eg\")\n", Rd_tag = "VERB")), Rd_tag = "\\dontrun"), │ │ │ │ - structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/updateSymbolsToValidKeys.Rd", class = "Rd", meta = list( │ │ │ │ + structure("\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/updateSymbolsToValidKeys.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ │ │ │ │ │ │ usedChromGenes (list) = structure(list(structure(list(structure("A function to select used genes on a chromosome from an ExpressionSet.", Rd_tag = "TEXT")), Rd_tag = "\\title"), │ │ │ │ structure(list(structure("usedChromGenes", Rd_tag = "VERB")), Rd_tag = "\\name"), │ │ │ │ structure(list(structure("usedChromGenes", Rd_tag = "VERB")), Rd_tag = "\\alias"), │ │ │ │ structure(list(structure("interface", Rd_tag = "TEXT")), Rd_tag = "\\keyword"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" Given an instance of an ", Rd_tag = "TEXT"), │ │ │ │ @@ -3105,10 +3105,10 @@ │ │ │ │ structure("\n", Rd_tag = "TEXT")), Rd_tag = "\\arguments"), │ │ │ │ structure(list(structure("\n", Rd_tag = "TEXT"), structure(" Returns a vector of gene names that represent the genes from the\n", Rd_tag = "TEXT"), │ │ │ │ structure(" ", Rd_tag = "TEXT"), structure(list(structure("ExpressionSet", Rd_tag = "RCODE")), Rd_tag = "\\code"), │ │ │ │ structure(" that are on the specified chromosome.\n", Rd_tag = "TEXT")), Rd_tag = "\\value"), │ │ │ │ structure(list(structure(" Jeff Gentry", Rd_tag = "TEXT")), Rd_tag = "\\author"), │ │ │ │ structure(list(structure("\n", Rd_tag = "RCODE"), structure(" data(sample.ExpressionSet)\n", Rd_tag = "RCODE"), │ │ │ │ structure(" data(hgu95AProbLocs)\n", Rd_tag = "RCODE"), │ │ │ │ - structure(" usedChromGenes(sample.ExpressionSet, \"1\", hgu95AProbLocs)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/home/moeller/Salsa/r-bioc-annotate/man/usedChromGenes.Rd", class = "Rd", meta = list( │ │ │ │ + structure(" usedChromGenes(sample.ExpressionSet, \"1\", hgu95AProbLocs)\n", Rd_tag = "RCODE")), Rd_tag = "\\examples")), Rdfile = "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/usedChromGenes.Rd", class = "Rd", meta = list( │ │ │ │ docType = character(0), generator = ""), prepared = 3L) │ │ ├── ./usr/lib/R/site-library/annotate/help/annotate.rdx │ │ │ ├── annotate.rdx-content │ │ │ │ ├── Rscript --vanilla -e 'args <- commandArgs(TRUE); readRDS(args[1])' {} │ │ │ │ │ @@ -1,355 +1,355 @@ │ │ │ │ │ $variables │ │ │ │ │ $variables$ACCNUMStats │ │ │ │ │ -[1] 278 1728 │ │ │ │ │ +[1] 294 1744 │ │ │ │ │ │ │ │ │ │ $variables$GO2heatmap │ │ │ │ │ -[1] 2284 2113 │ │ │ │ │ +[1] 2329 2127 │ │ │ │ │ │ │ │ │ │ $variables$GOmnplot │ │ │ │ │ -[1] 4672 2102 │ │ │ │ │ +[1] 4745 2117 │ │ │ │ │ │ │ │ │ │ $variables$`HTMLPage-class` │ │ │ │ │ -[1] 7055 3285 │ │ │ │ │ +[1] 7157 3301 │ │ │ │ │ │ │ │ │ │ $variables$LL2homology │ │ │ │ │ -[1] 10621 3068 │ │ │ │ │ +[1] 10752 3084 │ │ │ │ │ │ │ │ │ │ $variables$PMIDAmat │ │ │ │ │ -[1] 13966 1614 │ │ │ │ │ +[1] 14127 1628 │ │ │ │ │ │ │ │ │ │ $variables$PWAmat │ │ │ │ │ -[1] 15854 1447 │ │ │ │ │ +[1] 16043 1462 │ │ │ │ │ │ │ │ │ │ $variables$UniGeneQuery │ │ │ │ │ -[1] 17580 1720 │ │ │ │ │ +[1] 17798 1733 │ │ │ │ │ │ │ │ │ │ $variables$accessionToUID │ │ │ │ │ -[1] 19580 1803 │ │ │ │ │ +[1] 19825 1819 │ │ │ │ │ │ │ │ │ │ $variables$annPkgName │ │ │ │ │ -[1] 21660 1525 │ │ │ │ │ +[1] 21935 1542 │ │ │ │ │ │ │ │ │ │ $variables$aqListGOIDs │ │ │ │ │ -[1] 23464 1426 │ │ │ │ │ +[1] 23771 1440 │ │ │ │ │ │ │ │ │ │ $variables$blastSequences │ │ │ │ │ -[1] 25169 3840 │ │ │ │ │ +[1] 25504 3854 │ │ │ │ │ │ │ │ │ │ $variables$buildChromLocation │ │ │ │ │ -[1] 29292 1389 │ │ │ │ │ +[1] 29653 1402 │ │ │ │ │ │ │ │ │ │ $variables$buildPubMedAbst │ │ │ │ │ -[1] 30964 1308 │ │ │ │ │ +[1] 31348 1323 │ │ │ │ │ │ │ │ │ │ $variables$chrCats │ │ │ │ │ -[1] 32549 5838 │ │ │ │ │ +[1] 32959 5852 │ │ │ │ │ │ │ │ │ │ $variables$`chromLocation-class` │ │ │ │ │ -[1] 38668 4093 │ │ │ │ │ +[1] 39107 4108 │ │ │ │ │ │ │ │ │ │ $variables$compatibleVersions │ │ │ │ │ -[1] 43043 1295 │ │ │ │ │ +[1] 43510 1307 │ │ │ │ │ │ │ │ │ │ $variables$dropECode │ │ │ │ │ -[1] 44614 1861 │ │ │ │ │ +[1] 45106 1877 │ │ │ │ │ │ │ │ │ │ $variables$entrezGeneByID │ │ │ │ │ -[1] 46756 1452 │ │ │ │ │ +[1] 47279 1468 │ │ │ │ │ │ │ │ │ │ $variables$entrezGeneQuery │ │ │ │ │ -[1] 48490 1464 │ │ │ │ │ +[1] 49042 1481 │ │ │ │ │ │ │ │ │ │ $variables$filterGOByOntology │ │ │ │ │ -[1] 50239 1529 │ │ │ │ │ +[1] 50821 1545 │ │ │ │ │ │ │ │ │ │ $variables$findNeighbors │ │ │ │ │ -[1] 52047 4194 │ │ │ │ │ +[1] 52660 4210 │ │ │ │ │ │ │ │ │ │ $variables$genbank │ │ │ │ │ -[1] 56515 2566 │ │ │ │ │ +[1] 57158 2581 │ │ │ │ │ │ │ │ │ │ $variables$getAnnMap │ │ │ │ │ -[1] 59357 3021 │ │ │ │ │ +[1] 60029 3035 │ │ │ │ │ │ │ │ │ │ $variables$getEvidence │ │ │ │ │ -[1] 62655 1299 │ │ │ │ │ +[1] 63355 1315 │ │ │ │ │ │ │ │ │ │ $variables$getGOTerm │ │ │ │ │ -[1] 64230 2561 │ │ │ │ │ +[1] 64961 2575 │ │ │ │ │ │ │ │ │ │ $variables$getOntology │ │ │ │ │ -[1] 67069 1793 │ │ │ │ │ +[1] 67828 1809 │ │ │ │ │ │ │ │ │ │ $variables$getPMInfo │ │ │ │ │ -[1] 69139 1308 │ │ │ │ │ +[1] 69928 1324 │ │ │ │ │ │ │ │ │ │ $variables$getSYMBOL │ │ │ │ │ -[1] 70728 3544 │ │ │ │ │ +[1] 71544 3558 │ │ │ │ │ │ │ │ │ │ $variables$getSeq4Acc │ │ │ │ │ -[1] 74549 1625 │ │ │ │ │ +[1] 75393 1641 │ │ │ │ │ │ │ │ │ │ $variables$getTDRows │ │ │ │ │ -[1] 76451 3991 │ │ │ │ │ +[1] 77325 4008 │ │ │ │ │ │ │ │ │ │ $variables$hasGOannote │ │ │ │ │ -[1] 80718 1480 │ │ │ │ │ +[1] 81624 1497 │ │ │ │ │ │ │ │ │ │ $variables$hgByChroms │ │ │ │ │ -[1] 82476 988 │ │ │ │ │ +[1] 83412 1003 │ │ │ │ │ │ │ │ │ │ $variables$hgCLengths │ │ │ │ │ -[1] 83741 819 │ │ │ │ │ +[1] 84706 836 │ │ │ │ │ │ │ │ │ │ $variables$hgu95AProbLocs │ │ │ │ │ -[1] 84843 1566 │ │ │ │ │ +[1] 85837 1582 │ │ │ │ │ │ │ │ │ │ $variables$hgu95Achroloc │ │ │ │ │ -[1] 86689 1313 │ │ │ │ │ +[1] 87713 1329 │ │ │ │ │ │ │ │ │ │ $variables$hgu95Achrom │ │ │ │ │ -[1] 88281 1290 │ │ │ │ │ +[1] 89335 1306 │ │ │ │ │ │ │ │ │ │ $variables$hgu95All │ │ │ │ │ -[1] 89848 1280 │ │ │ │ │ +[1] 90931 1297 │ │ │ │ │ │ │ │ │ │ $variables$hgu95Asym │ │ │ │ │ -[1] 91406 1274 │ │ │ │ │ +[1] 92520 1290 │ │ │ │ │ │ │ │ │ │ $variables$`homoData-class` │ │ │ │ │ -[1] 92957 3594 │ │ │ │ │ +[1] 94102 3611 │ │ │ │ │ │ │ │ │ │ $variables$htmlpage │ │ │ │ │ -[1] 96828 4772 │ │ │ │ │ +[1] 98002 4785 │ │ │ │ │ │ │ │ │ │ $variables$isValidkey │ │ │ │ │ -[1] 101876 2402 │ │ │ │ │ +[1] 103078 2418 │ │ │ │ │ │ │ │ │ │ $variables$makeAnchor │ │ │ │ │ -[1] 104555 1092 │ │ │ │ │ +[1] 105787 1108 │ │ │ │ │ │ │ │ │ │ $variables$mapOrgs │ │ │ │ │ -[1] 105922 1240 │ │ │ │ │ +[1] 107183 1255 │ │ │ │ │ │ │ │ │ │ $variables$organism │ │ │ │ │ -[1] 107437 1215 │ │ │ │ │ +[1] 108726 1229 │ │ │ │ │ │ │ │ │ │ $variables$pm.abstGrep │ │ │ │ │ -[1] 108930 1815 │ │ │ │ │ +[1] 110247 1832 │ │ │ │ │ │ │ │ │ │ $variables$pm.getabst │ │ │ │ │ -[1] 111022 2070 │ │ │ │ │ +[1] 112369 2085 │ │ │ │ │ │ │ │ │ │ $variables$pm.titles │ │ │ │ │ -[1] 113367 1215 │ │ │ │ │ +[1] 114742 1229 │ │ │ │ │ │ │ │ │ │ $variables$pmAbst2HTML │ │ │ │ │ -[1] 114862 3499 │ │ │ │ │ +[1] 116265 3513 │ │ │ │ │ │ │ │ │ │ $variables$pmid2MIAME │ │ │ │ │ -[1] 118642 1095 │ │ │ │ │ +[1] 120071 1110 │ │ │ │ │ │ │ │ │ │ $variables$pmidQuery │ │ │ │ │ -[1] 120013 1307 │ │ │ │ │ +[1] 121471 1322 │ │ │ │ │ │ │ │ │ │ $variables$`pubMedAbst-class` │ │ │ │ │ -[1] 121602 3810 │ │ │ │ │ +[1] 123086 3825 │ │ │ │ │ │ │ │ │ │ $variables$pubmed │ │ │ │ │ -[1] 125686 2372 │ │ │ │ │ +[1] 127198 2388 │ │ │ │ │ │ │ │ │ │ $variables$readGEOAnn │ │ │ │ │ -[1] 128335 3013 │ │ │ │ │ +[1] 129877 3028 │ │ │ │ │ │ │ │ │ │ $variables$serializeEnv │ │ │ │ │ -[1] 131626 2534 │ │ │ │ │ +[1] 133198 2550 │ │ │ │ │ │ │ │ │ │ $variables$setRepository │ │ │ │ │ -[1] 134437 2850 │ │ │ │ │ +[1] 136041 2865 │ │ │ │ │ │ │ │ │ │ $variables$updateSymbolsToValidKeys │ │ │ │ │ -[1] 137575 1829 │ │ │ │ │ +[1] 139208 1843 │ │ │ │ │ │ │ │ │ │ $variables$usedChromGenes │ │ │ │ │ -[1] 139684 1481 │ │ │ │ │ +[1] 141345 1499 │ │ │ │ │ │ │ │ │ │ │ │ │ │ │ $references │ │ │ │ │ $references$`env::1` │ │ │ │ │ -[1] 0 278 │ │ │ │ │ +[1] 0 294 │ │ │ │ │ │ │ │ │ │ $references$`env::10` │ │ │ │ │ -[1] 21383 277 │ │ │ │ │ +[1] 21644 291 │ │ │ │ │ │ │ │ │ │ $references$`env::11` │ │ │ │ │ -[1] 23185 279 │ │ │ │ │ +[1] 23477 294 │ │ │ │ │ │ │ │ │ │ $references$`env::12` │ │ │ │ │ -[1] 24890 279 │ │ │ │ │ +[1] 25211 293 │ │ │ │ │ │ │ │ │ │ $references$`env::13` │ │ │ │ │ -[1] 29009 283 │ │ │ │ │ +[1] 29358 295 │ │ │ │ │ │ │ │ │ │ $references$`env::14` │ │ │ │ │ -[1] 30681 283 │ │ │ │ │ +[1] 31055 293 │ │ │ │ │ │ │ │ │ │ $references$`env::15` │ │ │ │ │ -[1] 32272 277 │ │ │ │ │ +[1] 32671 288 │ │ │ │ │ │ │ │ │ │ $references$`env::16` │ │ │ │ │ -[1] 38387 281 │ │ │ │ │ +[1] 38811 296 │ │ │ │ │ │ │ │ │ │ $references$`env::17` │ │ │ │ │ -[1] 42761 282 │ │ │ │ │ +[1] 43215 295 │ │ │ │ │ │ │ │ │ │ $references$`env::18` │ │ │ │ │ -[1] 44338 276 │ │ │ │ │ +[1] 44817 289 │ │ │ │ │ │ │ │ │ │ $references$`env::19` │ │ │ │ │ -[1] 46475 281 │ │ │ │ │ +[1] 46983 296 │ │ │ │ │ │ │ │ │ │ $references$`env::2` │ │ │ │ │ -[1] 2006 278 │ │ │ │ │ +[1] 2038 291 │ │ │ │ │ │ │ │ │ │ $references$`env::20` │ │ │ │ │ -[1] 48208 282 │ │ │ │ │ +[1] 48747 295 │ │ │ │ │ │ │ │ │ │ $references$`env::21` │ │ │ │ │ -[1] 49954 285 │ │ │ │ │ +[1] 50523 298 │ │ │ │ │ │ │ │ │ │ $references$`env::22` │ │ │ │ │ -[1] 51768 279 │ │ │ │ │ +[1] 52366 294 │ │ │ │ │ │ │ │ │ │ $references$`env::23` │ │ │ │ │ -[1] 56241 274 │ │ │ │ │ +[1] 56870 288 │ │ │ │ │ │ │ │ │ │ $references$`env::24` │ │ │ │ │ -[1] 59081 276 │ │ │ │ │ +[1] 59739 290 │ │ │ │ │ │ │ │ │ │ $references$`env::25` │ │ │ │ │ -[1] 62378 277 │ │ │ │ │ +[1] 63064 291 │ │ │ │ │ │ │ │ │ │ $references$`env::26` │ │ │ │ │ -[1] 63954 276 │ │ │ │ │ +[1] 64670 291 │ │ │ │ │ │ │ │ │ │ $references$`env::27` │ │ │ │ │ -[1] 66791 278 │ │ │ │ │ +[1] 67536 292 │ │ │ │ │ │ │ │ │ │ $references$`env::28` │ │ │ │ │ -[1] 68862 277 │ │ │ │ │ +[1] 69637 291 │ │ │ │ │ │ │ │ │ │ $references$`env::29` │ │ │ │ │ -[1] 70447 281 │ │ │ │ │ +[1] 71252 292 │ │ │ │ │ │ │ │ │ │ $references$`env::3` │ │ │ │ │ -[1] 4397 275 │ │ │ │ │ +[1] 4456 289 │ │ │ │ │ │ │ │ │ │ $references$`env::30` │ │ │ │ │ -[1] 74272 277 │ │ │ │ │ +[1] 75102 291 │ │ │ │ │ │ │ │ │ │ $references$`env::31` │ │ │ │ │ -[1] 76174 277 │ │ │ │ │ +[1] 77034 291 │ │ │ │ │ │ │ │ │ │ $references$`env::32` │ │ │ │ │ -[1] 80442 276 │ │ │ │ │ +[1] 81333 291 │ │ │ │ │ │ │ │ │ │ $references$`env::33` │ │ │ │ │ -[1] 82198 278 │ │ │ │ │ +[1] 83121 291 │ │ │ │ │ │ │ │ │ │ $references$`env::34` │ │ │ │ │ -[1] 83464 277 │ │ │ │ │ +[1] 84415 291 │ │ │ │ │ │ │ │ │ │ $references$`env::35` │ │ │ │ │ -[1] 84560 283 │ │ │ │ │ +[1] 85542 295 │ │ │ │ │ │ │ │ │ │ $references$`env::36` │ │ │ │ │ -[1] 86409 280 │ │ │ │ │ +[1] 87419 294 │ │ │ │ │ │ │ │ │ │ $references$`env::37` │ │ │ │ │ -[1] 88002 279 │ │ │ │ │ +[1] 89042 293 │ │ │ │ │ │ │ │ │ │ $references$`env::38` │ │ │ │ │ -[1] 89571 277 │ │ │ │ │ +[1] 90641 290 │ │ │ │ │ │ │ │ │ │ $references$`env::39` │ │ │ │ │ -[1] 91128 278 │ │ │ │ │ +[1] 92228 292 │ │ │ │ │ │ │ │ │ │ $references$`env::4` │ │ │ │ │ -[1] 6774 281 │ │ │ │ │ +[1] 6862 295 │ │ │ │ │ │ │ │ │ │ $references$`env::40` │ │ │ │ │ -[1] 92680 277 │ │ │ │ │ +[1] 93810 292 │ │ │ │ │ │ │ │ │ │ $references$`env::41` │ │ │ │ │ -[1] 96551 277 │ │ │ │ │ +[1] 97713 289 │ │ │ │ │ │ │ │ │ │ $references$`env::42` │ │ │ │ │ -[1] 101600 276 │ │ │ │ │ +[1] 102787 291 │ │ │ │ │ │ │ │ │ │ $references$`env::43` │ │ │ │ │ -[1] 104278 277 │ │ │ │ │ +[1] 105496 291 │ │ │ │ │ │ │ │ │ │ $references$`env::44` │ │ │ │ │ -[1] 105647 275 │ │ │ │ │ +[1] 106895 288 │ │ │ │ │ │ │ │ │ │ $references$`env::45` │ │ │ │ │ -[1] 107162 275 │ │ │ │ │ +[1] 108438 288 │ │ │ │ │ │ │ │ │ │ $references$`env::46` │ │ │ │ │ -[1] 108652 278 │ │ │ │ │ +[1] 109955 292 │ │ │ │ │ │ │ │ │ │ $references$`env::47` │ │ │ │ │ -[1] 110745 277 │ │ │ │ │ +[1] 112079 290 │ │ │ │ │ │ │ │ │ │ $references$`env::48` │ │ │ │ │ -[1] 113092 275 │ │ │ │ │ +[1] 114454 288 │ │ │ │ │ │ │ │ │ │ $references$`env::49` │ │ │ │ │ -[1] 114582 280 │ │ │ │ │ +[1] 115971 294 │ │ │ │ │ │ │ │ │ │ $references$`env::5` │ │ │ │ │ -[1] 10340 281 │ │ │ │ │ +[1] 10458 294 │ │ │ │ │ │ │ │ │ │ $references$`env::50` │ │ │ │ │ -[1] 118361 281 │ │ │ │ │ +[1] 119778 293 │ │ │ │ │ │ │ │ │ │ $references$`env::51` │ │ │ │ │ -[1] 119737 276 │ │ │ │ │ +[1] 121181 290 │ │ │ │ │ │ │ │ │ │ $references$`env::52` │ │ │ │ │ -[1] 121320 282 │ │ │ │ │ +[1] 122793 293 │ │ │ │ │ │ │ │ │ │ $references$`env::53` │ │ │ │ │ -[1] 125412 274 │ │ │ │ │ +[1] 126911 287 │ │ │ │ │ │ │ │ │ │ $references$`env::54` │ │ │ │ │ -[1] 128058 277 │ │ │ │ │ +[1] 129586 291 │ │ │ │ │ │ │ │ │ │ $references$`env::55` │ │ │ │ │ -[1] 131348 278 │ │ │ │ │ +[1] 132905 293 │ │ │ │ │ │ │ │ │ │ $references$`env::56` │ │ │ │ │ -[1] 134160 277 │ │ │ │ │ +[1] 135748 293 │ │ │ │ │ │ │ │ │ │ $references$`env::57` │ │ │ │ │ -[1] 137287 288 │ │ │ │ │ +[1] 138906 302 │ │ │ │ │ │ │ │ │ │ $references$`env::58` │ │ │ │ │ -[1] 139404 280 │ │ │ │ │ +[1] 141051 294 │ │ │ │ │ │ │ │ │ │ $references$`env::6` │ │ │ │ │ -[1] 13689 277 │ │ │ │ │ +[1] 13836 291 │ │ │ │ │ │ │ │ │ │ $references$`env::7` │ │ │ │ │ -[1] 15580 274 │ │ │ │ │ +[1] 15755 288 │ │ │ │ │ │ │ │ │ │ $references$`env::8` │ │ │ │ │ -[1] 17301 279 │ │ │ │ │ +[1] 17505 293 │ │ │ │ │ │ │ │ │ │ $references$`env::9` │ │ │ │ │ -[1] 19300 280 │ │ │ │ │ +[1] 19531 294 │ │ │ │ │ │ │ │ │ │ │ │ │ │ │ $compressed │ │ │ │ │ [1] TRUE │ │ ├── ./usr/lib/R/site-library/annotate/help/paths.rds │ │ │ ├── paths.rds-content │ │ │ │ ├── Rscript --vanilla -e 'args <- commandArgs(TRUE); readRDS(args[1])' {} │ │ │ │ │ @@ -1,60 +1,60 @@ │ │ │ │ │ - [1] "/home/moeller/Salsa/r-bioc-annotate/man/ACCNUMStats.Rd" │ │ │ │ │ - [2] "/home/moeller/Salsa/r-bioc-annotate/man/GO2heatmap.Rd" │ │ │ │ │ - [3] "/home/moeller/Salsa/r-bioc-annotate/man/GOmnplot.Rd" │ │ │ │ │ - [4] "/home/moeller/Salsa/r-bioc-annotate/man/HTMLPage-class.Rd" │ │ │ │ │ - [5] "/home/moeller/Salsa/r-bioc-annotate/man/LL2homology.Rd" │ │ │ │ │ - [6] "/home/moeller/Salsa/r-bioc-annotate/man/PMIDAmat.Rd" │ │ │ │ │ - [7] "/home/moeller/Salsa/r-bioc-annotate/man/PWAmat.Rd" │ │ │ │ │ - [8] "/home/moeller/Salsa/r-bioc-annotate/man/UniGeneQuery.Rd" │ │ │ │ │ - [9] "/home/moeller/Salsa/r-bioc-annotate/man/accessionToUID.Rd" │ │ │ │ │ -[10] "/home/moeller/Salsa/r-bioc-annotate/man/annPkgName.Rd" │ │ │ │ │ -[11] "/home/moeller/Salsa/r-bioc-annotate/man/aqListGOIDs.Rd" │ │ │ │ │ -[12] "/home/moeller/Salsa/r-bioc-annotate/man/blastSequences.Rd" │ │ │ │ │ -[13] "/home/moeller/Salsa/r-bioc-annotate/man/buildChromLocation.Rd" │ │ │ │ │ -[14] "/home/moeller/Salsa/r-bioc-annotate/man/buildPubMedAbst.Rd" │ │ │ │ │ -[15] "/home/moeller/Salsa/r-bioc-annotate/man/chrCats.Rd" │ │ │ │ │ -[16] "/home/moeller/Salsa/r-bioc-annotate/man/chromLocation-class.Rd" │ │ │ │ │ -[17] "/home/moeller/Salsa/r-bioc-annotate/man/compatibleVersions.Rd" │ │ │ │ │ -[18] "/home/moeller/Salsa/r-bioc-annotate/man/dropECode.Rd" │ │ │ │ │ -[19] "/home/moeller/Salsa/r-bioc-annotate/man/entrezGeneByID.Rd" │ │ │ │ │ -[20] "/home/moeller/Salsa/r-bioc-annotate/man/entrezGeneQuery.Rd" │ │ │ │ │ -[21] "/home/moeller/Salsa/r-bioc-annotate/man/filterGOByOntology.Rd" │ │ │ │ │ -[22] "/home/moeller/Salsa/r-bioc-annotate/man/findNeighbors.Rd" │ │ │ │ │ -[23] "/home/moeller/Salsa/r-bioc-annotate/man/genbank.Rd" │ │ │ │ │ -[24] "/home/moeller/Salsa/r-bioc-annotate/man/getAnnMap.Rd" │ │ │ │ │ -[25] "/home/moeller/Salsa/r-bioc-annotate/man/getEvidence.Rd" │ │ │ │ │ -[26] "/home/moeller/Salsa/r-bioc-annotate/man/getGOTerm.Rd" │ │ │ │ │ -[27] "/home/moeller/Salsa/r-bioc-annotate/man/getOntology.Rd" │ │ │ │ │ -[28] "/home/moeller/Salsa/r-bioc-annotate/man/getPMInfo.Rd" │ │ │ │ │ -[29] "/home/moeller/Salsa/r-bioc-annotate/man/getSYMBOL.Rd" │ │ │ │ │ -[30] "/home/moeller/Salsa/r-bioc-annotate/man/getSeq4Acc.Rd" │ │ │ │ │ -[31] "/home/moeller/Salsa/r-bioc-annotate/man/getTDRows.Rd" │ │ │ │ │ -[32] "/home/moeller/Salsa/r-bioc-annotate/man/hasGOannote.Rd" │ │ │ │ │ -[33] "/home/moeller/Salsa/r-bioc-annotate/man/hgByChroms.Rd" │ │ │ │ │ -[34] "/home/moeller/Salsa/r-bioc-annotate/man/hgCLengths.Rd" │ │ │ │ │ -[35] "/home/moeller/Salsa/r-bioc-annotate/man/hgu95AProbLocs.Rd" │ │ │ │ │ -[36] "/home/moeller/Salsa/r-bioc-annotate/man/hgu95Achroloc.Rd" │ │ │ │ │ -[37] "/home/moeller/Salsa/r-bioc-annotate/man/hgu95Achrom.Rd" │ │ │ │ │ -[38] "/home/moeller/Salsa/r-bioc-annotate/man/hgu95All.Rd" │ │ │ │ │ -[39] "/home/moeller/Salsa/r-bioc-annotate/man/hgu95Asym.Rd" │ │ │ │ │ -[40] "/home/moeller/Salsa/r-bioc-annotate/man/homoData-class.Rd" │ │ │ │ │ -[41] "/home/moeller/Salsa/r-bioc-annotate/man/htmlpage.Rd" │ │ │ │ │ -[42] "/home/moeller/Salsa/r-bioc-annotate/man/isValidkey.Rd" │ │ │ │ │ -[43] "/home/moeller/Salsa/r-bioc-annotate/man/makeAnchor.Rd" │ │ │ │ │ -[44] "/home/moeller/Salsa/r-bioc-annotate/man/mapOrgs.Rd" │ │ │ │ │ -[45] "/home/moeller/Salsa/r-bioc-annotate/man/organism.Rd" │ │ │ │ │ -[46] "/home/moeller/Salsa/r-bioc-annotate/man/pm.abstGrep.Rd" │ │ │ │ │ -[47] "/home/moeller/Salsa/r-bioc-annotate/man/pm.getabst.Rd" │ │ │ │ │ -[48] "/home/moeller/Salsa/r-bioc-annotate/man/pm.titles.Rd" │ │ │ │ │ -[49] "/home/moeller/Salsa/r-bioc-annotate/man/pmAbst2HTML.Rd" │ │ │ │ │ -[50] "/home/moeller/Salsa/r-bioc-annotate/man/pmid2MIAME.Rd" │ │ │ │ │ -[51] "/home/moeller/Salsa/r-bioc-annotate/man/pmidQuery.Rd" │ │ │ │ │ -[52] "/home/moeller/Salsa/r-bioc-annotate/man/pubMedAbst-class.Rd" │ │ │ │ │ -[53] "/home/moeller/Salsa/r-bioc-annotate/man/pubmed.Rd" │ │ │ │ │ -[54] "/home/moeller/Salsa/r-bioc-annotate/man/readGEOAnn.Rd" │ │ │ │ │ -[55] "/home/moeller/Salsa/r-bioc-annotate/man/serializeEnv.Rd" │ │ │ │ │ -[56] "/home/moeller/Salsa/r-bioc-annotate/man/setRepository.Rd" │ │ │ │ │ -[57] "/home/moeller/Salsa/r-bioc-annotate/man/updateSymbolsToValidKeys.Rd" │ │ │ │ │ -[58] "/home/moeller/Salsa/r-bioc-annotate/man/usedChromGenes.Rd" │ │ │ │ │ + [1] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/ACCNUMStats.Rd" │ │ │ │ │ + [2] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/GO2heatmap.Rd" │ │ │ │ │ + [3] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/GOmnplot.Rd" │ │ │ │ │ + [4] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/HTMLPage-class.Rd" │ │ │ │ │ + [5] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/LL2homology.Rd" │ │ │ │ │ + [6] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/PMIDAmat.Rd" │ │ │ │ │ + [7] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/PWAmat.Rd" │ │ │ │ │ + [8] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/UniGeneQuery.Rd" │ │ │ │ │ + [9] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/accessionToUID.Rd" │ │ │ │ │ +[10] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/annPkgName.Rd" │ │ │ │ │ +[11] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/aqListGOIDs.Rd" │ │ │ │ │ +[12] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/blastSequences.Rd" │ │ │ │ │ +[13] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/buildChromLocation.Rd" │ │ │ │ │ +[14] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/buildPubMedAbst.Rd" │ │ │ │ │ +[15] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/chrCats.Rd" │ │ │ │ │ +[16] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/chromLocation-class.Rd" │ │ │ │ │ +[17] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/compatibleVersions.Rd" │ │ │ │ │ +[18] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/dropECode.Rd" │ │ │ │ │ +[19] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/entrezGeneByID.Rd" │ │ │ │ │ +[20] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/entrezGeneQuery.Rd" │ │ │ │ │ +[21] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/filterGOByOntology.Rd" │ │ │ │ │ +[22] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/findNeighbors.Rd" │ │ │ │ │ +[23] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/genbank.Rd" │ │ │ │ │ +[24] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getAnnMap.Rd" │ │ │ │ │ +[25] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getEvidence.Rd" │ │ │ │ │ +[26] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getGOTerm.Rd" │ │ │ │ │ +[27] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getOntology.Rd" │ │ │ │ │ +[28] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getPMInfo.Rd" │ │ │ │ │ +[29] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getSYMBOL.Rd" │ │ │ │ │ +[30] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getSeq4Acc.Rd" │ │ │ │ │ +[31] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/getTDRows.Rd" │ │ │ │ │ +[32] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hasGOannote.Rd" │ │ │ │ │ +[33] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hgByChroms.Rd" │ │ │ │ │ +[34] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hgCLengths.Rd" │ │ │ │ │ +[35] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hgu95AProbLocs.Rd" │ │ │ │ │ +[36] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hgu95Achroloc.Rd" │ │ │ │ │ +[37] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hgu95Achrom.Rd" │ │ │ │ │ +[38] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hgu95All.Rd" │ │ │ │ │ +[39] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/hgu95Asym.Rd" │ │ │ │ │ +[40] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/homoData-class.Rd" │ │ │ │ │ +[41] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/htmlpage.Rd" │ │ │ │ │ +[42] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/isValidkey.Rd" │ │ │ │ │ +[43] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/makeAnchor.Rd" │ │ │ │ │ +[44] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/mapOrgs.Rd" │ │ │ │ │ +[45] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/organism.Rd" │ │ │ │ │ +[46] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pm.abstGrep.Rd" │ │ │ │ │ +[47] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pm.getabst.Rd" │ │ │ │ │ +[48] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pm.titles.Rd" │ │ │ │ │ +[49] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pmAbst2HTML.Rd" │ │ │ │ │ +[50] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pmid2MIAME.Rd" │ │ │ │ │ +[51] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pmidQuery.Rd" │ │ │ │ │ +[52] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pubMedAbst-class.Rd" │ │ │ │ │ +[53] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/pubmed.Rd" │ │ │ │ │ +[54] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/readGEOAnn.Rd" │ │ │ │ │ +[55] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/serializeEnv.Rd" │ │ │ │ │ +[56] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/setRepository.Rd" │ │ │ │ │ +[57] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/updateSymbolsToValidKeys.Rd" │ │ │ │ │ +[58] "/build/reproducible-path/r-bioc-annotate-1.90.0+dfsg/man/usedChromGenes.Rd" │ │ │ │ │ attr(,"first") │ │ │ │ │ -[1] 41 │ │ │ │ │ +[1] 58